Table 1.

B. subtilis strains, plasmids, and oligonucleotides used in this study

Strain, plasmid, or oligonucleotideGenotype or characteristicsaReference, source, or derivationb
Strains
 CU1065W168trpC2 attSPβLab stock
 JH642W168trpC2 pheA1Lab stock
 ZB307AW168 SPβc2Δ2::Tn917::pSK10Δ6; MLSr22
 HB4247JH642sigW::kanpKF90→JH642
 HB0020CU1065sigW::kanHB4247→CU1065
 HB0010CU1065rsiW::kanpXH51→CU1065
 HB0008CU1065 fosB::pAG4041 (Cmr)pAG4041→CU1065
 HB8083ZB307A SPβ PfosB-cat-lacZ(MLSr Neor)pAG3839→ZB307A
 HB0052CU1065 SPβPfosB-cat-lacZ(MLSr Neor)Transduction
 HB0023HB0020 SPβ PfosB-cat-lacZ(MLSr Kanr)Transduction
 HB0012HB0010 SPβ PfosB-cat-lacZ(MLSr Kanr)Transduction
 HB0050CU1065 SPβ Pw-cat-lacZ (MLSrNeor)9
 HB0080CU1065::pMC82 (PxylA-fosB)This work
 HB0081HB0020::pMC82;sigW::kan(PxylA-fosB)This work
 HB0082HB0008::pMC82;fosB::cat(PxylA-fosB)This work
Plasmids
 pET17bT7 RNAP driven overexpression plasmidNovagen
 pXTDerivative of pDG1731; allows fusion of genes to xylose-inducible xylA promoter; integrates at thrC locusT. Msadek
 pJPM122Vector for integration of reporter fusions into SPβ (Apr Neor)18
 pJM114Kanamycin resistance cassette vector16
 pGEM-cat-3Zf(+)Cloning vector20
 pDG783Kanamycin resistance cassette vector6
 pKF84Contains sigWLab stock
 pKF90ContainssigW::kanConstruction analogous to sigW::MLS (reference 9)
 pXH50pGEM-cat-3Zf(+) carrying rsiWLab stock
 pXH51rsiW::kan in pGEM-cat-3Zf(+)Lab stock
 pAG4041pGEM-cat-3Zf(+) carrying internal fragment (330 bp) of fosB (PCR primers 275, 276)This work
 pAG3839pJPM122 carrying PfosB (PCR from 273, 274)This work
 pMC82pXT carrying fosB(PCR from 470, 309)This work
 pMC50pET17b withfosB (PCR from 308, 309)This work
Oligonucleotidesc
 275CGGAATTCAGTTTCGCATTTGGATACAfosB(internal; F)
 276CGTCTAGAAGCCTGTCTTGAAGGGTTfosB(internal; R)
 273GCGAAGCTTCCGTTTTTGTTTACACTGGTAfosBpromoter F
 274GCGGATCCTAGCAAGTGATTGATTCCTTTTAfosBpromoter R
 470CGCGGATCCATTCATAATGGTCATGTTfosBF
 309CCGGAATTCTGGTTGTGCTATCAAAfosBR
 370CCCTTTACCAAAAGCTTTGCACCfosB (for primer extension; R)
 308CTAGTCTAGACAGTCCGTTTTTGTTfosB(for overproduction; F)
  • a MLS, macrolides-lincosamides-streptogramin B; Neo, neomycin; Kan, Kanamycin, Ap, ampicillin; Cm, chloramphenicol.

  • b Arrows indicate transformation with either plasmid or chromosomal DNA as indicated.

  • c Introduced restriction sites used for cloning are underlined. F, forward; R, reverse (relative to fosB).