Table 1.

DNA probes for Southern blot hybridizations 

ProbeSizeOrganismPCR primera or cloned DNA fragmentSource or reference
sipC 1.2 kb S. enterica serovar TyphimuriumATGTTAATTAGTAATGTGGGAThis study
TTAAGCGCGAATATTGCCTGC
sipBc 1.4 kb S. entericaserovar TyphimuriumCTAAAAACGGCGGAGACAThis study
AATCGTTTCGCCCATCA
sipA 1.8 kb S. enterica serovar TyphimuriumCCGCAGTCAGAGCAAAGTThis study
TGCAATCTCAGCCAGTTTT
sptP 1.5 kb S. enterica serovar TyphimuriumAGTATTAACCTGGCTTGGAAAAThis study
CAAACTGTGAGGCGTCTTCC
avrA 1 kb S. enterica serovar Typhimurium EcoRV fragment of pSB1136Hardt and Galán, unpublished
sopBb 1.7 kb S. entericaserovar TyphimuriumTGCTCTAGACATGCAAATACAGAGCTTCTATCAThis study
AAGCTTGGCATAAAGGGACAGCACA
sopD 1 kb S. enterica serovar TyphiTAAGCTTCGGTAATCATCAAAThis study
TGCACCCATCTTTACCAAT
sopE 723 bp S. enterica serovar Typhimurium Acc65I-XbaI fragment of pSB1167Hardt and Galán, unpublished
sopE2 723 bp S. enterica serovar Typhimurium EcoRI-XbaI fragment of plasmid pM202 50
cysI 1.35 kb S. enterica serovar TyphimuriumGGGCGGGGTGATTACTAThis study
CCGCTTCACGCTCTTTC
p1201.3 kb S. enterica serovar TyphiGGACGCCTTTCTGACACAThis study
ATCGGTTGATGCTGGAAA
hpaB 1.35 kb S. enterica serovar TyphimuriumTTAACGGGCGAAGAGTATTThis study
TGGCTGCCCGAGTAGTT
Probe a1 kb S. enterica serovar TyphiGTTCGGCGCTCAGTCCThis study
AACGGCGAAAGCAAGAT
Probe b1.3 kb S. enterica serovar TyphiTCGTACCCAGGAGTCACATAThis study
CCCTGGCCTGAGAGAATC
  • a The sequences of both PCR primers are shown 5′ to 3′.

  • b Also includes 150 nt of the adjacentpipC gene.

  • c Also includes 50 nt of the adjacentsicA gene.