Table 1.

DNA probes for Southern blot hybridizations 

ProbeSizeOrganismPCR primera or cloned DNA fragmentSource or reference
sipC1.2 kbS. enterica serovar TyphimuriumATGTTAATTAGTAATGTGGGAThis study
TTAAGCGCGAATATTGCCTGC
sipBc1.4 kbS. entericaserovar TyphimuriumCTAAAAACGGCGGAGACAThis study
AATCGTTTCGCCCATCA
sipA1.8 kbS. enterica serovar TyphimuriumCCGCAGTCAGAGCAAAGTThis study
TGCAATCTCAGCCAGTTTT
sptP1.5 kbS. enterica serovar TyphimuriumAGTATTAACCTGGCTTGGAAAAThis study
CAAACTGTGAGGCGTCTTCC
avrA1 kbS. enterica serovar TyphimuriumEcoRV fragment of pSB1136Hardt and Galán, unpublished
sopBb1.7 kbS. entericaserovar TyphimuriumTGCTCTAGACATGCAAATACAGAGCTTCTATCAThis study
AAGCTTGGCATAAAGGGACAGCACA
sopD1 kbS. enterica serovar TyphiTAAGCTTCGGTAATCATCAAAThis study
TGCACCCATCTTTACCAAT
sopE723 bpS. enterica serovar TyphimuriumAcc65I-XbaI fragment of pSB1167Hardt and Galán, unpublished
sopE2723 bpS. enterica serovar TyphimuriumEcoRI-XbaI fragment of plasmid pM20250
cysI1.35 kbS. enterica serovar TyphimuriumGGGCGGGGTGATTACTAThis study
CCGCTTCACGCTCTTTC
p1201.3 kbS. enterica serovar TyphiGGACGCCTTTCTGACACAThis study
ATCGGTTGATGCTGGAAA
hpaB1.35 kbS. enterica serovar TyphimuriumTTAACGGGCGAAGAGTATTThis study
TGGCTGCCCGAGTAGTT
Probe a1 kbS. enterica serovar TyphiGTTCGGCGCTCAGTCCThis study
AACGGCGAAAGCAAGAT
Probe b1.3 kbS. enterica serovar TyphiTCGTACCCAGGAGTCACATAThis study
CCCTGGCCTGAGAGAATC
  • a The sequences of both PCR primers are shown 5′ to 3′.

  • b Also includes 150 nt of the adjacentpipC gene.

  • c Also includes 50 nt of the adjacentsicA gene.