Table 2.

Primers used to amplify the internal fragments of the given gene of pCLP

ORFa no. (homolog)Sequence of: Size of product (bp)
Forward primer (5′–3′) Antisense primer (5′–3′)b
1 (Rv3128c) CCTGGGCGCCCTCAAATCCGGCAGCTCTGATTCTTGGGCC 424
2 (pemI) CCCGGATGGAGGTGGGCG GCTTCACCGTTGAGCC 255
3 (pemK) ATTGCTCTGACGGAACGCGGCCCGCCGCGTGTTATAGGTAGC 152
2 and 3 (pem operon)GGACCCCCAGGTGCGACCGC CCGTTCGGGCAAAGTTCCCG 152
4CCGGCAAGACCTCGTCAGCC GCCAATGAGTAGTCCAGCGG 277
5GGACTACTCGTGTGGCGACAGC GCTGACGCGGCACAGGAACC 272
6GGTCGCCCGTGAATACCGG GCATCTTGCGCCCAATCGCC 293
7CGAGCGACGGTGATCCGTACCG GCGTCTATTGATGCCGAACACC 316
8 (Rv2813) CGTCATCTATCTGCCTGACC CGCGGCCGGCCAGCTTCAGG 413
9 (Rv2812) GGCAGACCCCGCTGGCCCGC CGGCGCGCCGGCCAGCCGC 200
10 CGCAGCCCGCGCGGGACAGC GGCGTCGAGTGCGCTCCGCC 223
11 (parA) GCCGTTGCCGGTTTCCCTCG CGGTTGATCGCCCACACCGC253
12 CCGCGCCGGCCTAGCGCCG CGGCGGTGTCGGCGTGCTGG 102
13 GCGCGCAGGCACGCGGACG CCCCCAGGTGGGGGCGACCC 288
14 (rep) GCCGGGCGTGGATCGAACGG ATCCGGCCGCCCCAAGAACC301
15 GCCGGCGTCGGTGGTGGCG GCTCGACCCACCGGCAGCCGG264
16 (Rv0921) GGGGAATCCGGCCACACGG CGGCGCGCCGGCCAGCCGC310
17 (Rv0922) GGCGCCGAAGTCGTTGACCGGGGCGGCATCAGCCAGGGC 316
18 CGGCCCCGCCGACGCACCGCGCCCGCGACGAAGCGTCGGG 277
19 CCGCCAGCGGCGTCATTGGGGTCCTGCCGACCCGCGGCG 268
  • a See Fig. 1 for location of ORFs on pCLP.

  • b These primers were also used to prime cDNA.