Table 1.

Oligonucleotide sequences

Oligo- nucleotide Sequence (5′ to 3′)
3-DetectTGTGGAATTGTGAGCGGATAACAATTTCAC
5-DetectGTTTTCCCAGTCACGACGTTGTAAAACGAC
ade2-3DRGGGTTGCCTTATCACCCAAGACATTCAACATAATAGCATTGGTGATGGAATGTGGAATTGTGAGCGGATA
ade2-5DRGTCCATTATATGCTGAAAAATGGTGTCCTTTCACCAAAGAATTGGCTGTGGTTTTCCCAGTCACGACGTT
Ade2amp3CCATCTTTCGCTCTGGTCTAGTAG
Ade2amp5GTCGATGACTTGTTACACATTGGG
Arg4detGGAATTGATCAATTATCTTTTGAAC
cdc25 3′DRTAAATTTTACGTTTTTATTGATTCGCTCTACTGTACAAACACTATGCTTAGCAAATACTATGTGGAATTGTGAGCGGATA
cdc25 5′DRAATATTATGAAACTTTTACTTGAAAAAAATTGGTCCATGTCGTATTACAATGAACCTGTAGTTTTCCCAGTCACGACGTT
Cdc25amp3CATTGTGTATTAGAAGTCTGTAGTTC
Cdc25amp5GGAATTGATATCTTTACTAATTGC
cdc28 3′DRCAGACCACATATCTACCCCAGTGGAATATTGTTTCCCTCCTGTGGAATTGTGAGCGGATA
cdc28 5′DRATTCGAGGTATTAAACATTGTCATTCTCATCGAGTTTTACGTTTTCCCAGTCACGACGTT
cdc25del1TGAAAACGGTTTGAAACTCTTGA
cdc25del2CATGTGTGCCATTTTTTGGTGTG
cdc25del3TGTCAAATCAGATAAGTACACACCA
cdc25del4CCAATCAATTGACTAACTTTGTTGG
cdc25del5TATCAATGCTCTCACTGAGCCCTG
cdc25del6TTTGCTCACTCCGACCAAGTTC
Cdc28amp3CCCTGAATATCCTGAAAAGCAATCG
Cdc28amp5GAAGATGAAGGTGTACCTAGTACC
cdc28-CCCCCTGAATATCCTGAAAAGCAATCG
cdc28-NCCAACTATAGAACACACACATCCCAAGCC
Kpn5′GGGGGTACCTGATTTCTAGAAGGACCACC
Rim20amp3GATTCCATAAACCAGGTTTACTAG
Rim20amp5GAGTGTAATCATTTGTTGCAAGAG
SNF1 dr 3′TTGATTTCGATTGCTGAGACGATGAGTTTCCTGCAGCAACTGTGGAATTGTGAGCGGATA
SNF1 dr 5′GCAAGTTCCGATCGACCCCGCTGCAAATCCAGCAAATAGAGTTTTCCCAGTCACGACGTT
Snf1amp3GTCTTTCACCAATGCATGATTC
Snf1amp5CATAATGAAAATCAATCGCAAC
SNF1claI-5′CCATCGATGAATCAATATATAGAAGAAGG
SNF1ecoRI-3′GGGGAATTCGCTCATCTTTAATTAGTTTCG
Xho3′-500GGGCTCGAGCATCAATTTATGATTTTTGAAG
YGR189 3′DRAGCTTGAAGAGGAGGAGGAAGATGATGATGATGATGATGAAGTGGTAGATGAAGGTGAGCGTGGAATTGTGAGCGGATA
YGR189 5′DRCCATACTTATGTTATTGATTGGACCAAAGATGCAGTTACTTGGTCCGTTGACGGTAGTGTTTTCCCAGTCACGACGTT
Ygr189amp3GAACTGCATTGGATTTTCGC
Ygr189amp5CTACTACTTATGATCGTGGT