Table 2.

Primers and probes used in this study

Primer pair or probeaSequenceDescriptionb
F1ATAAGTTAAGAGGGAAATATGAmplifies entire 1.94-kb hmuR gene
R1CATTTCGCACCCATGCCGAAG
F2ACTGGAATTCGTGTAGTAACAAAGCAGAmplifies 505 bp (8 to 493 nt) of hmuR gene; PCR product is probe 2
R2ACTGAAGCTTTGATGATATTTGATAACACC
F3ACGTGAATTCGTGTAGTAACAAAGCAGAmplifies 855 bp (8 to 853 nt) of hmuR gene
R3GCTGATACGCCAGTTGGCA
F4GAAATGGATCAGGCTATCTACAmplifies 1.2-kb junction fragment of hmuY-hmuR
R4GCTGATACGCCAGTTGGCA
F5GGTAAGCACCTGAAGACTTATGAmplifies 469 bp (84 to 552 nt) of the sod gene
R5CCAGTCAACAATACTCCAAAGA
F6GAAATGGATCAGGCTATCTACAmplifies 300 bp (85 to 384 nt) of the hmuY gene
R6GAGTTCTCCATCCTGATA
F7 R7ATGGCCAACCCTCCGGCCCAACCTA GAAAGTGATCCGAACCAACCCGTATAmplifies the hmuR gene without the signal peptide and without stop codon
F8ATGAAAAGTCTAGTAACAAAGCAGGAmplifies thehmuR gene with signal peptide and without stop codon
R7GAAAGTGATCCGAACCAACCCGTAT
Probe 1 ClaI-ClaI-digested internal fragment (696 bp) of the hmuR (nt 791 to 1436) gene (has aHindIII site at nt 1387)
  • a F, forward; R, reverse.

  • b nt, nucleotide(s).