Table 2.

Primers used

PrimerSequence (5′→3′)aPositionb
p1CGGGAAGCATGCATGCGGCCGCTCTCGAGAATGAGACGTTGA51–92
p2TATCACTTATGGTGACCTCGTACGAGATCTTTAAGGGCA912–874
p3gcgcgtcgacTGAGGTGCTCCAATGGC44–60
p4cgGGTAATCATGACTAGTTACTGGTAGTGTTTTAT768–736
p5AGAAACAGAAGCCACTGGAG70–51
p6TGCATGACAAAGTCATCGGG704–723
p7gggTGTACACTCGAGACGCTGGAAGAAATGCCGGAAAAATTAG921–961
p8CAGGAAACAGCTATGAC1,769–1,753
  • a Mutated or additional nucleotides used to introduce a restriction site are indicated by underlining or lowercase letters, respectively.

  • b Primers p1 and p2 hybridize to the pHSG398 sequence with coordinates 1 to 2,228 (59); primers p3 to p6 hybridize to the IS1 sequence with coordinates 1 to 768 (40); primer p7 hybridizes to plasmid pYS6 with thehns gene sequence with coordinates 1 to 1,380 (42); primer p8 hybridizes to pYS6 with the vector pSTV28 sequence with coordinates 1 to 2,999 according to Takara.