Table 1.

Putative Rho-independent terminators found in the D3 DNA sequence

SequenceaLocation
Direct
CCCGCCTTGAGCGGGTTTTTTTGT10019–10039
GCCCGGATCATTCCGGGCTTTTTCATT11255–11274
CCCGCTTCGGCGGGTTTTTTATT15432–15451
CCCGCCATAGAGCGGGCTTTCTTAT18597–18618
GCCCATCTAAATGTGGGCTTTATTTTAT23373–23397
CGCCGGCCCTCGAGCCGGCGTTTTTGTT24707–24728
Complement
GCCCGCCTAGCGCGGGCTTTTTCAT45047–45065
GCCCGGCAAGTCCGGGCATTTTTT43446–43466
  • a The region which might assume a stem-loop structure is bold-faced.