Table 1.

Characteristics of the primers used in this study

OligonucleotideSequence (5′ to 3′)aEnzymeStrand
R1GCG (GAATTC) GGAGGTGAAAGAAGGCGTTGEcoRI+
R2GCG (GAATTC) AAACCAAGCGCTATGCCGCCEcoRI
F1GGCCAGAAAATTACGTAG+
F2GACATCCAATTTGCCAAG
N1GCG (GAATTC) CTCGAACTTCTTTAGGATTGEcoRI+
N2GCG (GAATTC) CTTTCCACTGGGAAATCAAGEcoRI
R1IGCG (AGATCT) GCTCTTGATGAAGAGGGAGAGBglII+
R2IGCG (AGATCT) GCAACCAAGAGCGTAAAGTTTBglII
F1IGCG (AGATCT) GATCTTAAAGAGCGCGATCBglII+
F2IGCG (AGATCT) CTTTAGGCGGCTCTTTTAGBglII
N1IGCG (AGATCT)TCCGTTGTACAAAGAGCTTGBglII+
N2IGCG (AGATCT) GCAATTTCTAAGGATTTGCGBglII
  • a The restriction endonuclease site in each oligonucleotide sequence is in parentheses, and the enzyme that cut it is listed.