Table 2.

Oligonucleotides used for PCR amplification and nucleotide sequencing of the internal regions of genes fromM. ulcerans and M. marinum

OligonucleotideSequence, 5′→3′Expected PCR product size and putative gene functionReferenceNucleotide positions sequencedaGenBank accession no.b
adk-P1G(GT)ATCCCGCAGATCTCCACCadk-P1 + adk-P2, amplification of a 442-bp product from adk(adenylate kinase)This study114–486 AF271093
adk-P2CAC(CT)TCGTCCATGGTGCCGA AF271342
aroE-P1CCCGGTGAACTGCTCCACCTaroE-P1 + aroE-P2, amplification of a 467-bp product from aroE (shikimate dehydrogenase)This study304–748 AF271094
aroE-P2TGGCGGGCCGACAACACCGA AF271343
crtB-P1CGACGACATTCTGGACTCCTcrtB-P1 + crtB-P2, amplification of a 469-bp product from crtB (phytoene synthase)This study184–638 AF271095
crtB-P2GACACCACATCAGCACATCC AF271344
MT1TTCCTGACCAGCGAGCTGCCGMT1 + MT2, amplification of a 508-bp product from fbpA (32-kDa surface antigen) 55 476–893 AF271092
MT2CCCCAGTACTCCCAGCTGTGC AF271345
Tb11ACCAACGATGGTGTGTCCATTb11 + Tb12, amplification of a 439-bp product from groEL (65-kDa heat shock protein) 61 159–540 AF271096
Tb12CTTGTCGAACCGCATACCCT AF271346
1004RAGGAATTCTGGGTTTGACATGCACAGGA1004R + rRog, amplification of a 517-bp product from rrs (3′ region of the 16S rRNA gene) 48 1038–1491AF27302
rRogAAGGAGGTGATCCAGCCGCA AF271347
ppk-P1AGTTGCTGCTGCGTGAGCppk-P1 + ppk-P2, amplification of a 421-bp product from ppk (polyphosphate kinase)This study999–1395 AF271097
ppk-P2GATGTTGGCCTGCTCGTC AF271348
Z212TCG(GT)CCCAGTTCACGAC(GA)TTCCAZ212 + Z261, amplification of a 434-bp product from sod (superoxide dismutase) 69 144–534 AF271098
Z261CCAA(AG)CTCGAAGAGGCGCG(CG)GCCAA AF271349
  • a Numbering based on M. tuberculosis H37Rv except for crtB, which was based onM. marinum sequence (accession no. U92075) andrrs, which was based on E. coli 16S rRNA.

  • b Accession numbers are provided for the type strains of each species, M. ulcerans ATCC 19423 (upper line) and M. marinum NCTC 2275 (lower line).