Table 1.

Bacterial strains and plasmids used in this study

Strain, plasmid, or oligonucleotideRelevant markers and characteristicsReference or origin
Strains
E. coli TG1 supE Δthi(lac-proAB) hsdD5 (F+ traD36 proAB lacI q ZDM15) 14
L. lactis
  MG1363Plasmid-free derivative of L. lactis subsp. cremoris NCDO712, LacPrt 13
  Wg2Wild-type L. lactissubsp. cremoris strain harboring pWV05,prtP1 27
  SK11Wild-type L. lactissubsp. cremoris strain harboring pSK111,prtP3 9
Plasmids
 pBSSK+ Ampr, M13ori pBR322ori Stratagene
 pGEM-T EasyAmpr, M13ori pBR322ori, linear T-overhang vectorPromega
 pGhost 8Tetr, thermosensitive replicative plasmid in L. lactis 34
 pJIM2366Emr, promoter probe vector containingluxAB genes47
 pJIM2374Emr, integrative promoter probe vector containing luxABgenes7
 Integrative plasmids carrying  luxfusion
  pJIM3029PpepC-lux, XbaI fusion of pJIM2374 and pBSSK+ containing PpepC on a 654-bp fragmentThis work
  pJIM3030PpepN-lux, XbaI fusion of pJIM2374 and pBSSK+ containing PpepNon a 767-bp fragmentThis work
  pJIM3031PpepX-lux, XbaI fusion of pJIM2374 and pBSSK+ containing PpepX on a 687-bp fragmentThis work
  pJIM3032PpepF22-lux, XbaI fusion of pJIM2374 and pBSSK+ containing PpepF22 on a 654-bp fragmentThis work
  pJIM3063PpepF21-lux, SpeI fusion of pJIM2374 and pGEM-T Easy containing PpepF21 on a 772-bp fragmentThis work
  pJIM3066PpepA-lux, BamHI fusion of pJIM2374 and pGEM-T Easy containing PpepA on a 575-bp fragmentThis work
  pJIM3064PoppD-lux, SpeI fusion of pJIM2374 and pGEM-T Easy containing PoppD on a 587-bp fragmentThis work
  pJIM3065PoppA-lux, SpeI fusion of pJIM2374 and pGEM-T Easy containing PoppA on a 688-bp fragmentThis work
  pJIM3080PpepDA1-lux, SpeI fusion of pJIM2374 and pGEM-T Easy containing PpepDA1 on a 763-bp fragmentThis work
  pJIM3081PpepM-lux, SpeI fusion of pJIM2374 and pGEM-T Easy containing PpepM on a 913-bp fragmentThis work
  pJIM3082PpepP-lux, SpeI fusion of pJIM2374 and pGEM-T Easy containing PpepP on a 778-bp fragmentThis work
  pJIM3106PpepQ-lux, SpeI fusion of pJIM2374 and pGEM-T Easy containing PpepQ on a 760-bp fragmentThis work
  pJIM3118PpepT-lux, SpeI fusion of pJIM2374 and pGEM-T Easy containing PpepT on a 866-bp fragmentThis work
 Replicative plasmids carrying  luxfusion
  PJIM3120PprtP1-lux, pJIM2366 carrying PprtP1 on a 1,051-bpSpeI-NotI fragment from strain Wg2This work
  pJIM3119PprtP3-lux, pJIM2366 carrying PprtP3 on a 1,056-bp SpeI-NotI fragment from strain SK11This work
Oligonucleotide pairs used for amplification or promoter and probe fragments
 PpepA GGGAATTCTAAAGTTTTGGCATT/CGGGATCCATAAATCCGACCTCAT X81089
 PpepC GGGAATTCCTTTGATTATTCATC/CGGGATCCAGATTGTTTTTGATTC M86245
 PpepDA1 TGTAGCAGACCTTGTATCAGC/GACATCGCAACATTAGCACTA AE005176
 PpepF21 GGGAATTCCAATTGAGCGAACTA/CGGGATCCTTGAGACGCTTAATA X99710
 PpepF22 GGGAATTCTAGTTTTATTCGTCA/CGGGATCCTTGATACTTTGCTTCTC X99710
 PpepM ACCTTTCCAGATGACCCGTTA/GTGCCTACTTTGGCTTGTTCA AE005176
 PpepN GGGAATTCTTGTTTTAAATGATGG/CGGGATCCTTCTTCTTCATCAAAT M87840
 PpepP TGGTTCGTCGTGAAGCACCAT/TCATCAGCAATTGCACAGGCT Y08842
 PpepT GCTATTGAGCCTTTTACT/GTTGTTCCATCAGTATGA L27596
 PpepQ TCTCCATCGATTGTTCCGACT/TCATCTGCTGACTTAATCAAA AE005176
 PpepX GGGAATTCCAAACATCGCACCTA/CGGGATCCCAATCTAATTCTATA M35865
 PoppD GGGAATTCTGCTTTTATTATTTCCT/CGGGATCCTACTTGTTCTAAAA L18760
 PoppA GGGAATTCTTTGGGAACAATGATAA/CGGGATCCGTTACTTCTGAACCA L18760
 PprtP CGGAATTCCTTGTACAAGCTACT/CGGAATTCAGCTTATTGTAATCA M26310
pepQ ATCCGACAACTCTAAATTATCT/TAGCAGCGCGAGCTCCTGATA AE005176
oppA AGCAGCTACACTCCTAAGTGCT/CGGGATCCGTTACTTCTGAACCA L18760
oppD AGTCTTAAACGTGGTGAAGT/CGGGATCCTACTTGTTCTAAAA L18760
 PpepDA2 TGAGGTTTCTGTCGCAGTCAT/CGGTCAGCAATGGTTACCTTA AE005176
dtpT TGACTCACGTCGTGACACTGGAT/TCCGTTCAAGAGACCTGGAAGT U05215
dtpP ACAGCACTCTATGCAAGGGTCATA/AGTCGCTGGATCAACCGCACGTT AE005176