Table 1.

Bacterial strains, phage, and plasmids used in the study

Strain, phage, or plasmidDescriptionSource or reference
E. coli
 ORN115thr-1 leuB thi-1 Δ(argF-lac)U169 xyl-7 ara-13 mtl-2 gal-6 rpsL tonA2 supE44 pilG1 λr Pil+(does not exhibit phase variation of piliation)31
 ORN174thr leu proA2 lacY1 galK his argE rpsL supE mtl xyl recBC sbcB tetR (inserted ca. 200 bp 3′ of the end offimH) Pil+24
 ORN178ORN115 excepttetR inserted ca. 200 bp 3′ of the end of fimH, Pil+24
 ORN201thr-1 leuB thi-1Δ(argF-lac)U169 xyl-7 ara-13 mtl-2 gal-6 rpsL tonA2 supE44 pilG1 λrrecA13Δ(fimBEACDEFGH)9
 ORN207ORN174 exceptfimH304::kanLinear transformation of ORN174 with EcoRI-digested pORN164a
 ORN208bORN115 exceptfimH304::kan with adjacenttetR, NalrP1 transduction from ORN207 to ORN115 and selection of a nalidixic acid-resistant variant
 ORN209ORN115 except fimH165 allele and adjacenttetR geneThis study
 ORN210ORN115 exceptfimH166 allele and adjacent tetR geneThis study
Bacteriophage
 P1virLaboratory collection
Plasmids
 pBR322ColE1 Apr Tcr1
 pKAS32coriR6K oriT rpsL Apr28
 pORN163dpBR322 fimHAprInsertion of a 2-kb PvuII fragment containing fimH from pORN127 (17) intoBamHI-cleaved pBR322
 pORN307pSH2 ΔfimH Cmr8
 pORN164pORN304fimH304::kan, has kan gene from Tn5 inserted in the XhoI site created as part of deletion in fimH304Kan cassette inserted intoXhoI site of pORN304 (8)
 pORN165pORN163 exceptfimH165This study
 pORN166pORN163 exceptfimH166This study
  • a Linear transformation and P1 transduction have been previously described (21).

  • b Strain ORN208 was used as the recipient in a mating and allelic exchange protocol (28) that introduced mutant fimH alleles into the chromosome, replacing thefimH insertion mutation.

  • c Introduction of the fimH mutant alleles into the chromosome was accomplished by first subcloning each mutant fimH allele carried on the ca. 1.8–kbSalI-EcoRI fragment of pORN163 intoSalI-EcoRI-digested pGEM11ZF (Promega) and then removing an EcoRI-XbaI fragment containing thefimH allele. (The new restriction endonuclease sites on the ends of the fimH alleles were contributed by the polylinker in pGEM11ZF.) EcoRI-XbaI fragments containing thefimH alleles were introduced intoEcoRI-XbaI-cleaved pKAS32 and then introduced into the chromosome of strain ORN208 by allelic exchange (28). Refer to Fig. 1 for a diagram.

  • d PCR-generated mutant fimH genes were obtained by amplification using primers 5′GGGTTATTGTCTCATGAGCG and 5′CCGATCATCGTCGCGCTCCA flanking EcoRI and SalI sites in pBR322. PCR amplicons were digested with EcoRI and SalI, and the SalI-EcoRI fragments were isolated and ligated into SalI-EcoRI-cleaved pBR322. This ligation mixture was introduced into strain LE392 (19) by electroporation (25). Following electroporation, electroporant colonies were harvested and the plasmid DNA was extracted (4) and introduced into strain ORN201 harboring pORN307, as described in the text.