Table 2.

Primers used in this study

PrimerSequenceaDescription or use
415AGATTAGATGAATTCGAAGCTAAATACPrimer in gldD; EcoRI site added
409TATTTTTTACTGCAGCTTTAAAGTTTCPrimer ingldD; PstI site added
214TACGCCAGCCTGCAGAATATTAAAPrimer ingldE; PstI site added
212TTTTAACATTTAAAGCTTTGTTGTTTTPrimer ingldE; HindIII site added
70ATAGTAGGGGATATAAGCGPrimer within gldE
377ATAAGTAAGCTTTTGCGCPrimer within gldD
73AACATCAACAATTCTGTAG gldE 5′ RACEb primer
378ATATTGTTTCGGCTGGCG gldE 5′ RACE primer
59CTCGCTGCCGGCATAATCGAATC gldD 5′ RACE primer
474AATAAAATAAACCGATCCTGC gldD 5′ RACE primer
  • a Underlining indicates added sites.

  • b RACE, rapid amplification of cDNA ends.