Table 1.

Oligonucleotides

PrimerSequenceaTargetbReference
AN47FGTTACGCACTGAAATTCCAC L. lactis hrcA (828)4
AN48rT7 TAATACGACTCACTATAGCTACAGGTCCTACAACTG L. lactis hrcA (1174)4
AN49FGCAAAATGTGCAACGTCGCG L. lactis grpE(1496)4
AN50rT7 TAATACGACTCACTATAGCTGTCAGCTGGATGTTCG L. lactis grpE (1781)4
AN51FGCAGTTATCACTGTTCCTGC L. lactis dnaK(2264)4
AN52rT7 TAATACGACTCACTATAGCTTGACCAAGGTCGATTCCG L. lactis dnaK (2603)4
AN64TGCAAGCACCAATCTTCATC L. lactis subsp.cremoris 16S rRNA16
AN65ACCCGACAAGGAATTTCGCEubacterial 23S rRNA1
AN66FTTGGCTTATTGGCAGTTGC L. lactis dnaK(∼4336)4
AN67rT7 TAATACGACTCACTATAGCTGACAGCCCAATTGCCG L. lactis dnaK (∼4675)4
AN68RAGCACTCTTTACCTCTAAG L. lactis hrcA 4
LLC68Cy3Cy3-TGCAAGCACCAATCTTCATC L. lactis subsp.cremoris 16S rRNA16
EUB1933Cy3-ACCCGACAAGGAATTTCGCEubacterial 23S rRNA1
  • a The nucleotide sequences are shown with the 5′ end to the left. T7 polymerase tail sequences are in bold.

  • b Numbers in parentheses refer to the starting position according to the nucleotide sequence of the dnaKoperon (4).