Table 2.

Summary of putative ςB-dependent genes subject to additional ςB-independent stress inductiona

GeneFunction or nearest homolog (E value)Regulatory region or potential promoter sequencesOperon structureInduction ratiob
wtsigB
PredictedValidatedEtOHHeatSaltEtOHHeatSalt
ctsRNegative transcriptional regulator of class III stress genesTCAGGTTTTGTGGACCGGGAAAATGGAAATAATGAAGG(A)T(A)1st+9.0104.26.58.12.8
mcsAModulator of CtsR repressionctsR mcsAB clpC sms yacKoperon2nd+3.35.41.94.34.41.5
mcsBModulator of CtsR repressionctsR mcsAB clpC sms yacKoperon3rd+10165.414153.4
clpCClass III stress response-related ATPasectsR yacHI clpC sms yacKoperon4th+5.8195.07.4132.3
smsDNA repair protein homolog BH0104, B. halodurans (e-178)ctsR yacHI clpC sms yacKoperon5th+6.24.64.24.53.03.2
yacKPutative DNA-binding protein SCE9403,Streptomyces coelicolor (1e-80)ctsR yacHI clpC sms yacK operon6th+3.53.23.74.52.23.3
yacLPutative glutamyl-tRNA-transferase,Listeria monocytogenes(e-108)TTTCGGTTAAAACCTTATGAATACGGGTATATTAATGTT(G)GTTm2.43.22.52.52.21.9
yceCResistance protein CdrC, C. acetobutylicum(2e-43)AAACGTATATATTAGT.AATTTACGGCTTATTTT-N61-GTG1st2.91.99.66.12.212
yceDResistance protein CdrC, C. acetobutylicum (7e-63)Potential yceCDEFGHoperon2nd3.21.86.85.71.78.8
yceEResistance protein CdrC, C. acetobytylicum (1e-74)Potential yceCDEFGHoperon3rd2.71.46.28.32.512
yceFToxic anion resistance protein YkoY, B. subtilis (4e-28)Potential yceCDEFGHoperon4th2.11.65.24.01.67.3
yceGNo similarityPotential yceCDEFGHoperon5th2.73.26.84.13.07.9
yceHTellurite resistance protein TelA, R. sphaeroides (1e-30)Potential yceCDEFGHoperon6th1.72.54.93.63.19.6
ycnHcSuccinate-semialdehyde DH GabD,B. halodurans(e-141)AACGGATTACTTTTGC.TGACAGCGGGAATTAACGGTA(A)TATCm136.34.5114.02.0
yjbCConserved protein BH2863, B. halodurans(8e-21)GGCTGTTTAAACAAGA.AGAAATGGGGTATATCTAAAAGT(A)TG1st+8.93.89.2183.218
yjbDConserved protein BH2861, B. halodurans (1e-56)yjbCDoperon2nd+4.82.32.75.62.44.1
ypuDNo similarityTACGGTTTTTTATTCATGAAAAAAAGGAATAACT-N40-ATGm2.22.31.63.41.82.5
yqjLProbable hydrolase PA2934, P. aeruginosa(2e-05)CCCTGTTCAATACGAA.AGAGGCTGGTAATGCCC-N104-ATGm5.15.62.09.45.22.8
sodASuperoxide dismutase (EC1.15.1.1 )GCAGGTTTAATGGGGCAGATTATCGGTTAAAGTG-N132-ATGm5.33.13.05.43.71.3
yraAIntracellular proteinase I PfpI, P. furiosus(4e-28)GATTGATATTTCCACATTGTAATAGGTTAGTCCT-N118-ATGm6.93.63.59.13.22.0
trxAThioredoxinTCAGGTTTTAAAACAGCTCCGGCAGGGCATGGTAAAGTAC(A)TGm+6.93.93.94.82.91.7
yvgNPutative morphine dehydrogenase YtbE, B. subtilis(e-116)AAGCGTATTATTGGTATCGGCTGAGAGGAATGTGA-N44-GTGm3.16.12.87.67.42.4
clpPATP-dependent Clp protease proteolytic subunit (EC3.4.21.92 )GATGGTTTGAACCCCTGTATTTTTGGGGAAAATGGGAAAA(AG)Am+2.6175.14.9184.1
yvyDRibosomal protein S30AE family, B. halodurans(7e-62)TTATGTTTCAGCAGGAATTGTAAAGGGTAAAAGAGAAAT(A)GAm+4.62.12.08.50.60.5
  • a For details on the data presentation, see Table 1, footnotes a through e.

  • b Calculated by dividing the relative hybridization signals of individual genes in the induced sample of the wild type (wt) or the sigB mutant by the respective control values. For experimental details, see Materials and Methods. EtOH, ethanol.

  • c Expression pattern has been verified by Northern blot analysis.