Table 1.

Summary of ςB-dependent general stress genes

GeneaFunction or nearest homolog (E value)bRegulatory region or potential promoter sequencecOperon structureInduction ratiof
PredicteddValidatedeEtOH, 10 min/coEtOH, wt/sigBHeat, wt/sigBSalt, wt/sigBEtOH,rsbX/sigB
yaaHCortical fragment-lytic enzyme SleL, Bacillus cereus(e-120)Potential yaaIHoperon2nd4.33.31.93.07.4
yaaIIsochorismatase (EntB) homolog, A. fulgidus(1e-21)CAAAGTTTTTTCATTGCCTAAAAAGGCTACATAT-N33-TTG1st16152.13.51.9
ctcProbable ribosomal protein L25, Pseudomonas aeruginosa(1e-18)CGAGGTTTAAATCCTTATCGTTATGGGTATTGTTTGTAAT(A)GG1st+8.2279.18.421
spoVCPeptidyl-tRNA hydrolase (Pth), stage V sporulation protein C (1e-106)ctc spoVCoperon2nd+8.48.42.13.22.7
ybdTFatty acid beta-hydroxylating cytochrome P450 (CypC) (<1e-180)GTCGGAAGATTAACGTGAAAATAGAGGGTAAAAAG-N17-ATGm6.56.34.24.139
ybyBUnknown conserved protein BH2666, B. halodurans(7e-08)ACAGGTTTAGCAATTT.CCAAAACGGGAATGATA-N38-ATGm40120531.7273
ycbKProbable integral membrane protein CJ0860,Campylobacter jejuni(2e-07)AAAGGTGTTATTCTGACTGCTCAAGGATATACGC-N55-ATGm8.06.32.56.31.2
ycbPConserved hypothetical protein YndM, B. subtilis(6e-11)TAAGGTTTAACTTTTT.ACATTTGAGGAATTATA-N34-ATGm2031142312
ycdFGlucose 1-dehydrogenase II, B. megaterium(2e-66)TGCTGTTTTCAACTCGGAAAAACAGGGTATTTTC-N35-ATG1st16156.321191
ycdGOligo-1,6-glucosidase (EC 3.2.1.10 ), B. thermoglucosidasius (<1e-180)Potential ycdFGoperon2nd7.45.22.13.222
nadENH3-dependent NAD+synthetase (EC6.3.5.1 )TCATGATTCATTTTCATTGATTTAGGGAAATGATCAGT(A)ATAm+3.22.31.48.73.1
ydaDHypothetical oxidoreductase YhdF, B. subtilis(e-113)CCATGTTTATCCAAAGAGTGTGTGAGGTACACAACAAA(TA)GA1st+1321101659168
ydaENo similarityydaDEoperon2nd+66529.9367.3
ydaGProbable general stress protein 26, D. radiodurans(7e-04)TCTTGTTTAAATCTTCCCCGGATGTGGAAAAGTAACAG(C)GGAm+6.49.03.41559
ydaPPyruvate dehydrogenase-related protein, T. acidophilum(e-103)CCGGGTTTTAAAGCCTTTCTCCTGTGGTATTGAAAAAA(GG)AAm+22309.818155
ydaSConserved hypothetical membrane protein YwzA,B. subtilis(5e-06)AAGTGTTTCGAAATGATCAGGAGCGGTTATTGAT-N29-ATGm5.33.21.42.76.7
ydaTNo similarityATGCGTTTTTATTTTT.CACCTGCGGGTACCATT-N27-ATGm3.93.62.44.49.6
gsiBEmbryonic abundant protein Em1,Arabidopsis thaliana(4e-18)GTTTGTTTAAAAGAAT.TGTGAGCGGGAATACAACAAC(CA)ACm+61641644263
ydbDManganese-containing catalase BH2190, B. halodurans(e-102)TTTCGTTTATCTTTCT.ATCGATCGGAAATATAA-N31-ATGm83759.818454
rsbVAnti-anti-sigma factor of SigBAAAGGTTTAACGTCTGTCAGACGAGGGTATAAAGCCAACT(A)G1st+4.86.04.61512
rsbWSwitch protein/serine kinase, anti-sigma factor of SigBrsbVW sigB rsbXoperon2nd+7.18.63.81318
sigBRNA polymerase general stress sigma factorrsbVW sigB rsbXoperon3rd+7.1157.38.751
rsbXPP2C type serine phosphatasersbVW sigB rsbX operon4th+5.89.96.28.216
yfnIAnion-binding protein homolog, YflE, B. subtilis(<e-180)TGTTGTGTGATGCCTTGATTTTGTTTGGAAAAGAAG-N34-ATGm5.6122.36.814
yflTNo similarityATCTGTTTCAGGTACA.GACGATCGGGTATGAAA-N33-ATGm10520258283646
yflHUnknown conserved protein BH2390, B. halodurans(5e-08)GCAGGTTTAACCTCCTCCAATTGCAGGTAAAGCA-N28-ATGm135.52.22.511
yflAAmino acid transporter BH4033, B. halodurans(8e-68)AAAGGTTTATGTTTTTCCATCTATGGGAAATGAT-N25-ATGm3.35.22.77.43.6
yfkMGeneral stress protein BH3025, B. halodurans(3e-64)GAATGTTTATTTTAGT.GTGGCTGGGGTAGAGTG-N36-ATGm24265.917171
yfkJProtein-tyrosine-phosphatase BH2238, B. halodurans(5e-46)GAAGGTTTCTTTTTAGAGAAATAGGGGCAAAGAA-N17-ATG1st118.72.1146.0
yfkINo similarityPotential yfkJIHoperon2nd21143.03811
yfkHHypothetical protein YfkH, B. cereus(5e-59)Potential yfkJIHoperon3rd4.33.31.33.78.5
yfhDNo similarityPotential yfhFEDoperon3rd6.84.93.27.19.2
yfhENo similarityPotential yfhFEDoperon2nd2.32.91.52.24.9
yfhFCell division inhibitor SLR1223,Synechocystis sp. (6e-54)ACGCGTTTTCTTTTAT.TACAATGAGGTAAAGTA-N30-ATG1st4.02.81.92.73.9
yfhKConserved hypothetical protein YwsB, B. subtilis(1e-22)TTATGTTTGGCTTTGCAAACAAAGGGGAATAGGA-N84-TTG1st8.5117.25243
yfhLgHypothetical protein YvaZ, B. subtilis (5e-05)Potential yfhKLMoperon2nd5.33.42.01.81.2
yfhMEpoxide hydrolase-related protein DR2549,D. radiodurans (9e-61)Potential yfhKLMoperon3rd9.83.42.72.11.5
yhcMORF DG1040 (fragment), D. discoideum(4e-06)TAACGGTTAATTTGTCTAACGAGGGGGAAAATAT-N23-ATGm8.97.32.15.652
ygxBCmpX, Pseudomonas fluorescens(6e-10)ATCTGTTTGCTTATTG.GATAAGTGGGTAAACAC-N31-TTGm272161890
yhdFOxidoreductase (short chain DH/Red.) BH1511,B. halodurans(e-104)TGGCGTTTATTCATTTCTGTCGTGTGGTAACGTTCAGT(A)TCm115.12.12.40.9
yhdNProbable oxidoreductase PA1127, P. aeruginosa(e-112)AAAGGTTTAACATTTTTTCCAGAGGGGAAAAGAT-N25-ATGm+2.98.84.99.432
yheKYxiE, B. subtilis(5e-12)AAAGGTTAATTGTGCT.CAAATTCGGGTAGTAGT-N30-ATGm8.1135.12833
yhxDRibitol dehydrogenase, Z. mobilis(6e-66)ACATGTTTTTCTGCTTATGCTCAGGGGTACACAT-N35-ATGm4.87.92.41.915
yitTUnknown conserved protein BH2916, B. halodurans(6e-99)TCGTGTTCAAATATTT.GTTTTAAGGGAAAACAT-N30-ATGm6.24.91.25.17.9
yjcENo similarityTGCCGTTTTACAAGAA....ACACGGGTATCGCG-N122-ATGm3.26.33.8365.7
yjgBNo similarityGGCTGTTTAAACAAGA.AGAAATGGGGTATATCT-N38-ATGm37384.81236
yjgCFormate dehydrogenase homolog YrhE, B. subtilis(<e-180)GTATGTTTTATTGAGTTGTTGTAAGGGAACTGAA-N40-ATG1st34245.21747
yjgDhConserved hypothetical protein YrhD, B. subtilis (4e-11)yjgCDoperon2nd83881864120
ykgAHypothetical protein BH1779, B. halodurans(3e-64)AATGGTTTAATGATTTTCATGATGAGGGAATAATA-N33-ATGm20263.8116.7
ykzAOrganic hydroperoxide resistance protein Ohr,P. aeruginosa(2e-21)GCATGTTTAAAAAGAT..CAGAAAGGGAAATATAACAACT(A)Gm+7914736162238
yknAPutative deoxycytidylate deaminase, C. arietinum(1e-27)GAATGTTCTTTGCATT..CTTTTCGGCTATACTA-N29-ATGm4.14.11.42.02.1
ykuTUnknown conserved protein BH2666, B. halodurans(4e-72)AAACGTTTAACATGGTCATGTACAGGGTAACTAG-N38-ATGm2.01.73.29.92.5
ykzIUnknown conserved protein BH2636, B. halodurans(2e-06)GCGCGTTTGAAGTAAGGAGAAATGTGGTAATAAA-N139-ATGm13246.53817
ylxPUnknown conserved protein BH2412, B. halodurans(2e-21)AGAAGTTTCACAAGGCTATGAATGTGGTATTACA-N71-GTGm4.6101.62.318
ymzBUnknown conserved protein BH1784, B. halodurans(5e-04)TCCCGTGTAAAAGATGCAGCAATTGGGAATAGTA-N24-TTGm6.19.21.42.723
yoxCNo similarityTTCTGATTAAAAAAAC.GGATACAGGGTAATGAC-N20-ATGm16263.41014
yocBNo similarityTCAGGTTTGATCGTTT.TTAAGAGAGGAAAAAGA-N30-ATGm2931127.460
yocKDnaK suppressor DksA, Chlamydia pneumoniae(3e-16)CCATGTTTGACAGAAG.GCAAAACGGGAAACAGG-N20-ATGm14365.33.027
bmrUMultidrug resistance proteinCTTCGTTTACTGCTTACAGAAAAAGGGGATTATATAACC(A)GA1st+5.83.81.24.43.3
bmrgMultidrug efflux transporterbmrU bmr bmrRoperon2nd+1.11.11.12.70.7
bmrRgTranscriptional regulator (MerR family)bmrU bmr bmrRoperon3rd+4.31.51.11.53.4
yqxLMg2+ and Co2+ transport protein CorA, A. aeolicus(2e-11)ACTGGTTTAGTGACGC.GGTTATTGGGCAATTAA-N33-ATGm8.0113.61225
yqhBPutative membrane protein with hemolysin domain,C. jejuni(3e-68)ACATGTTTTATGAGCATTTTCAGGTGGTATGGAA-N29-ATGm5.26.73.06.012
yqgZhArsenate reductase BH3485, B. halodurans(3e-16)AATGGTTTAAATGAAAAATGATCCGGGTAGTTAT-N37-ATGm5.410176257337
bofCForespore regulator of the sigma K checkpointPotential csbX bofCoperon2nd+5.26.42.73.660
csbXα-Ketoglutarate permeaseACAGGATTACAATTCAGCAAGCTTGGGTATATACTCCATT(G)A1st+7.98.94.04.35.1
ysnFHypothetical protein DR1314, D. radiodurans(1e-13)TTTTGTTTAATTCAAA.GAACAGCGGGAATTACA-N46-ATGm+1161941640398
ytxJGeneral stress protein BH3013, B. halodurans (7e-11)ytxGHJoperon3rd+8.85.65.4235.2
ytxHSeed maturation protein PM30, Glycine max (6e-04)ytxGHJoperon2nd+7.74.47.4266.8
ytxGGeneral stress protein BH3245, B. halodurans(2e-19)ACATGTTTATGATTGA.AGAAAACGGGTAAACAGCAG(T)ATAT1st+7.75.010385.7
dpsDNA-protecting proteinAGAGGTTTTAGCGTAG.ATATTAAGGGTATACATAGTCAT(A)Tm+20471111131
ytiARibosomal protein L31, B. halodurans(9e-30)TGAGGTTTACGATGTG.AAACAGAGGGAAGGATA-N75-ATGm13256.1161.0
ytaBORF168 protein, A. rubrum(6e-07)GGGGGTTTGATATTTATAAGATAAAGGGTAATTAA-N21-ATGm9.3122.61228
yugUUnknown conserved protein BH3498, B. halodurans(2e-48)TCGGGTTTATGAGAGCGGTTTAACAGGAAAAAAAA-N21-ATGm3.03.21.93.53.8
yuzAHypothetical conserved protein BH3345, B. halodurans(7e-22)GATGGTTTTATTTTGCAAGGTGCTGGGAAAGAAG-N113-ATGm13112.63.41.6
yvrESenescence marker protein-30 (SMP30-fam.),Xenopus aevis(2e-50)AGTGGTTTGGACACCT.CTTTGCCGGGAATAACA-N32-ATGm12124.01433
yvgOHypothetical 19.6-kDa protein, B. amyloliquefaciens(1e-53)TTGAGATTACAAATACATTGAGCAGGGTATGCCT-N36-TTGm107.03.85.10.9
yvaAHypothetical oxidoreductase YdgJ,Escherichia coli(2e-76)TTAGGTTTTACCATTTGATCAGGAGGGTATATAC-N35-GTGm10126.31320
yvaJ3′-to-5′ exoribonuclease RNase RyvaK yvaJ operon2nd7.15.11.73.012
yvaKCarboxylesterase precursor (EC 3.1.1.1 ),B. stearothermophilus(2-107)AAACGTTTTTTTCTGATTAAACTGTGGAAAACTA-N28-ATG1st6.67.81.53.510
gtaBUTP-glucose-1-phosphate uridylyltransferase (EC2.7.7.9 )AAATGTGTAAAAACATATTGAAAAGGGTAAATGTGCTGT(A)GTm+5.24.42.06.14.6
ywtGd-Xylose-proton symporter XylT,L. breyis(e-113)AAAGGTTTAATGGCCGGAAAAAGAGGCTAAAAGA-N60-ATGm4.74.51.83.579
ywsBHypothetical protein YfhK, B. subtilis(2e-22)TGATGTTTAGGAACCTGCGATAACGTGAATAGAG-N42-ATGm18612015960
csbDNo similarityGAATGTTTATTGCCTC.TCAGATCGGGAAGTTAA-N34-ATGm602406624521
ywmENo similarityATTGGTTTAAAAACAG.TTTGGGCGGGAATGATA-N21-ATGm8.46.53.14.16.3
ywjCNo similarityATAGGTTTACGACTTGTCAGCTTTGGGAACTTAG-N36-ATGm7.216101369
ywiECardiolipin synthetase BH2858, B. halodurans(e-115)CAAGGTTTATCGATTAGAAAAAAGAGGTAATACA-N32-ATGm2.42.31.32.62.6
ywzAConserved hypothetical protein YdaS, B. subtilis(2e-06)AGTTGTTTATCTTATACAAAAAAGAGGAATGATA-N130-ATGm8814029208459
gspAPutative glycosyl transferase LgtC, P. multocida(6e-30)ACGTGTTTATTTTTTT.GAAAAAGGGTATGTAACTTGT(A)CAm+42883357395
yxzFNo similarityPotential yxlJ yxzFoperon2nd2.62.31.62.013
yxlJN-Methylpurine-DNA glycosylase,Mus musculus(3-e21)AGCCGTTTTTTTTGAT.CTGCTTCGGGAATGGAT-N36-GTG1st4.23.21.63.05.3
katXCatalase X (EC1.11.1.6 )GGCTGTTTTAAAATCTTTCCATTCAGGGAATATTGTTAC(C)GTm+5.23.81.62.011
yxkOHypothetical protein TM0922, T. maritima(2-e30)TTTTGTTTGAAAAAGAAAAGGGACAGGAAAAATA-N27-ATGm3.92.42.02.137
yxiSNo similaritykatB yxiSoperon2nd+3.64.03.07.99.2
katBCatalase 2 (EC1.11.1.6 )AGCAGTTTATATGAAGAACGCCACGGGTAAATGTGCTGT(A)GA1st+2.22.11.32.611
csbCMetabolite transport protein homolog YwtG,B. subtilis(e-115)AAATGTTTCAAATGAGATAGGAAATGGGTACTAATCT(A)TTAAm+4.33.62.26.673
yxbGProbable short-chain dehydrogenase PA1649,P. aeruginosa(1e-30)GCATGTTTATCACTGC.ACATAGCGGGAAGACAA-N23-ATGm2.72.01.43.08.7
yxnAGlucose 1-dehydrogenase II (EC 1.1.1.47 ),B. megaterium(4e-24)AGGGGTAAGACCCTTC..CGGATGGGGTAATGTA-N29-ATGm4.83.11.63.123
yxaBEpsL, S. thermophilus(4e-32)CAATGCATAGCCATCCTTCTTTTTGGGTAGAGAC-N45-ATGm8.58.51.93.67.1
yycDNo similarityGATCGTTTCGGACAGTAACAAGGCGGGAAAAATG-N27-ATGm33348.314104
  • a Genes are listed according to their order in the B. subtilis genome. Genes in bold letters were known from the literature to be ςB dependent prior to the DNA macroarray analysis.

  • b The function of the protein encoded is given if it has been supported by genetic or biochemical data. Otherwise the nearest homolog of the protein encoded is listed. The expect values (E values) given in parentheses were obtained with BLAST 2.0 searches using the BLOSUM 62 matrix against the SWALL-none redundant protein database. “No similarity” indicates that the E value was above e-03. In cases where the best homolog has not been characterized yet, the next possible homolog with known function is given instead.

  • c The presumed −35 and −10 regions of potential ςB-dependent promoters and the start codon of the coding region are shown in boldface. The experimentally determined 5′ ends of the mRNAs are represented by bold letters in parentheses. If the gene is not the first gene in an operon, the operon is shown instead of the regulatory region.

  • d Potential operon structures derived from theB. subtilis genome sequence. m, monocistronic; ordinal numbers indicate the position in the potential operon.

  • e Plus sign indicates verification of operon structure by Northern blot analysis.

  • f Calculated by dividing the normalized hybridization signals of individual genes in the induced sample or wild type (wt) by the relative intensities of the untreated controls. Values reflect averages of at least two independent array hybridizations. EtOH 10 min/co, RNA was prepared from a wild-type strain either immediately before or 10 min after treatment with 4% (vol/vol) ethanol; EtOH, heat, or salt, wt/sigB, ratios were obtained with RNAs prepared from the wild-type strain and the sigB mutant treated for 10 min with 4% (vol/vol) ethanol, 48°C, or 4% (wt/vol) NaCl; EtOH, rsbX/sigB, the ratios were obtained with RNA prepared from an rsbX suppressor mutant (BSA386) and thesigB mutant (BSA272) 60 min after addition of ethanol to a final concentration of 4% (vol/vol).

  • g Operon internal genes that do not fulfill the stringent expression criteria are included here if the flanking genes display ςB-dependent expression or if the operon structure has been proven by Northern blot analysis.

  • h The expression pattern has been verified by Northern blot analysis.