Table 2.

Oligonucleotide primers used in this studya

PrimerSequence (5′ to 3′)
CsrB PR.EXTCTGATGTTCACTTCGTTGTCTGACTCCCTG TCGACGAAGATAGA
CsrB5′-1GCATTTAGCCTCAAATCTTGCGG
CsrB3′-1CTCGAAGCTTCCGCAAAAAGAGCATCCAG
I-PCR-B-UPCGAAGTCTTACAAGGCGCTTACAG
I-PCR-B-DNATTCCTGCTATCCTTCGCGGC
CAM6TACCTGTGACGGAAGATCACTTCG
CAM7ACGAATAGGCGGCGACAGGCGGAC
  • a Primers were purchased from Integrated DNA Technologies Inc., Coralville, Iowa.