Table 3.

Oligonucleotide primers used for plasmid constructions

Region Template Primer, sequencea
aadA pWM5 aadA-5′, GCAATCGAT ACGGATGAAGGCACGAACC;
aadA-3′, GCAGCGGCCGC TCGGCTTGAACGAATTGTTAG
dhfrIIb p34E-Tp dhfrIIb-5′, GCAGGCGCC ACGAACCCAGTTGACATAAGC;
dhfrIIb-3′, GCAGCGGCCGC TTAGGCCACACGTTCAAGT
gen pBBR1MCS-5 gen-5′, GCAGGCGCC CACGAACCCAGTTGACATA;
gen-3′, GCAGCGGCCGC CTTGAACGAATTGTTAGG
ParaB pBAD33 ParaB -5′, AACTGCAG CGCCATTCAGAGAAGAAACCAA;
ParaB -3′, GCAGTCGACCATATGAATTCCTCCATCCAAAAAAACGGGTATGGAGA
PrhaS pAH151 PrhaS -5′, GCATCCGGA AATTCGCGACCTTCTCG;
PrhaS -3′, GCATCTAGAGCATATG GGCCTCCTGATGTCGTC
Psyn1-pstS pLD81 Psyn1 -5′, GCATCCGGAACTAGT GTCTTCAAGAATTCTAGG;
pstS-3′, CGGGATCCACGCGT TTACAAAGTC
xisλ λ xisλ -5′, CCGGAATTC TTGCGTGTAATTGCGGAGAC;
xisλ -3′, GGAAGATCT CCTTCGAAGGAAAGACCTGATGC
attP HK022 pEY109 attP HK022 #1, GCAGCTAGC TAATGCTCTGTCTCAGGTC;
attP HK022 #2, GCACC ATGG GACAAAATTGAAATCG
int HK022 pEY109 int HK022-5′, GCACCATG G TAAGTAGGTCATTATTAGTC;
int HK022-3′, GCAGAATTC GTAGCCTTTTGAAGAGG
xis-int HK022 pEY109 xis HK022-5′, GCAGAATTC TGCGGAGACTTTGC;
int HK022-3′, see above
attP P21 pBS1attP6-1 attP P21 #1, GCACCATGG AATGACCGACCGATA;
attP P21 #2, GCAGCTAGC ATAAGGCCTCGCAA
int P21 pBS1attP6-1 int P21-5′, GCAGAATTC AGAACCGCAACTCCCAA;
int P21-3′, GCACCATGG ATAACGGGCGTATAACA
xis-int P21 pBS1attP6-1 xis P21-5′, GCAGAATTC GCAGCTAAGAGGAGGAC;
int P21-3′, see above
attP P22s pJL110 attP P22 #1, GCAGCTAGC CGTTGTTACCGATCAAT;
attP P22 #2, GCACCATGG AAGGCACGAATAATACG
attP P22 P22 attP P22 #3, GCAGCTAGC CATTATGAAAATCAGCGGATTCGGA;
attP P22 #4, CATGCCATGG AATCACCTGACTGAACATGCTCGAC
int P22 P22 int P22-5′, GCAGAATTC CACCACACGACAAGCCT;
int P22-3′, GCACCATGG ACTCCTATTATCGGCAC
xis-int P22 P22 xis P22-5′, GCAGAATTC CTACGACATGCCTAACG;int P22-3′, see above
attP φ80s pJL10 attP φ80 #1, AACCGGT GAATCACGAC;
attP φ80 #2, GCACCATGG ACATCCTTGAAAGCCTG
attP φ80 pJL10 attP φ80 #3, GCATCTAGA GGTGAATCACGACAAAGCGTATC;
attP φ80 #4, CATGCCATGG GCCCGTGCGAATCAGAAATAAT
int φ80 pJL10 int φ80-5′, GCAGAATTCGCTAGC AACCCTTATCCAGCA;
int φ80-3′, GCACCATGG CAATCAAAGAGTGGGAG
xis φ80 pJL10 xis φ80-5′, GCAGAATTC GGCAACTGGAGAGAGCTAT;
xis φ80-3′, GCAGCTAGC AAGAGATCATCGGAGAG
  • a Restriction sites are italicized. Bases complementary to the template are underlined.