Table 4.

PCR tests for integration of CRIM plasmidsa

attP phagePrimer P1 sequencePrimer P4 sequenceTemp (°C)Predicted size(s) of PCR fragment(s) forattB withb:
No integrant with P1 and P4 Single integrant with P1 and P2, P3 and P4 Multiple integrant with P1 and P2, P3 and P2, P3 and P4
λGGCATCACGGCAATATACTCTGGTCTGGTAGCAATG 63 741577, 666 577, 502, 666
HK022 GGAATCAATGCCTGAGTG GGCATCAACAGCACATTC 59 740289, 824 289, 373, 824
φ80 CTGCTTGTGGTGGTGAATTAAGGCAAGACGATCAGG 63 546 409, 732 409, 595, 732
P21 ATCGCCTGTATGAACCTG TAGAACTACCACCTGACC 57 506568, 620 568, 682, 620
P22 AAGTGGATCGGCATTGGTTTCGTATCGACAGGAAGG 63 735 376, 926 376, 568, 926
e14attR CGCTTGAAGATGTGTGGT GTTACGGTCTTGGCATTG57 862 1,226, 389 1,226, 682, 389
P22(EcoB)AAGTGGATCGGCATTGGT CGATTGAACCGCAGATTACG 63 609 376, 801 376, 568, 801
  • a Primers P2 (ACTTAACGGCTGACATGG) and P3 (ACGAGTATCGAGATGGCA) are the same for allattP sites. “Temp” is the annealing temperature. The P4 priming sites for att P21 andatt P22 lie within prophage elements of wild-typeE. coli K-12 (Fig. 2). An att P21 CRIM plasmid integrates to the left (counterclockwise) of e14. The e14attR primers were used to test for integration to the right (clockwise) of e14. E. coli K-12, but not E. coli B, has an uncharacterized prophage inatt P22. An att P22 CRIM plasmid integrates adjacent (counterclockwise) to this prophage inE. coli K-12. Primers foratt P22(EcoB) were used to test for integration of att P22 CRIM plasmids in E. coliK-12 strains (BW25695 and others) with an “empty”att P22 site from E. coli B.

  • b Sizes are in nucleotides.