TABLE 2.

Primers used in this study

PrimerSequence (5′→3′)GenBank accession no.Nucleotide positions
hlbFGGTGCACTTACTGACX13404824-838
hlbRCGCATATACATCCCATGGC1678-1660
16S rRNAFGCGTGGGGATCAAACAGGX68417777-794
16S rRNARCCCCAATCATTTGTCCCACC1500-1481
splAFCGAAGGAGGTAAAATATGAATAAAAATGAF271715987-1013
splARGTGGTGTGAAATAAACACCGAAATTC1670-1645
sspAFCAACGAATGGTCATTATGCACCCAF309515598-620
sspARGGTACACCGCCCCAATGAATTCC1123-1101
gehFGCACAAGCCTCGGM12715808-820
gehRGACGGGGGTGTAG1280-1268
ureCFCTCGTGTAACACGTGATGACGTGAACGAP003136251461-251487
ureCRGGCGCATGACCGCCACCAGCACCTTC252139-252114
spaFAGACGATCCTTCGGTGAGCAAAGAU54636829-852
spaRGCTTTTGCAATGTCATTTACTGTAT1203-1179
sarSFGTCAAGCCTGAAGTCGATATGAB035454911-931
sarSRGCATGGTCTTGCTGCGCGTC1518-1499
rotFGTTTTGGGATTGTTGGGATGAF189239478-497
rotRGCATTGCTGTTGCTCTACTTGC924-903