TABLE 2.

Primers used in this study

PrimerSequence (5′-3′),a locationPCR amplificationRestriction site
YC71AAGCTTCGGATTGATATGAAGACAGAA, from −624 to −604 nt upstream of bla1 start codonForward primer for bla1 upstream regionHindIII
YC72GGATCCTTGCAATGCACCTCCTGTA, from 105 to 87 nt downstream of bla1 start codonReverse primer for bla1 upstream regionBamHI
YC73AAGCTTCATTCCGGATCAAATAAGTGC, from −790 to −770 nt upstream of bla2 start codonForward primer for bla2 upstream regionHindIII
YC74GGATCCTGCTCTACCTTTCGTTCTGC, from 104 to 85 nt downstream of bla2 start codonReverse primer for bla2 upstream regionBamHI
YC75GGTACCTGCAGTCGACGAATTCCCGGGGATCCGGTGForward primer for kanamycin-resistant gene and transcriptional terminatorKpnI
YC76GGTACCAGACATCTAAATCTAGGTACReverse primer for kanamycin-resistant gene and transcriptional terminatorKpnI
YC81GGATCCCGGATTGATATGAAGACAGAA, from −624 to −604 nt upstream of bla1 start codonForward primer for bla1 geneBamHI
YC82AAGAATCGCTTTCCAAGTTCA, from 55 to 38 nt downstream of bla1 stop codonReverse primer for bla1 gene
YC83GGATCCCATTCCGGATCAAATAAGTGC, from −790 to −770 nt upstream of bla2 start codonForward primer for bla2 geneBamHI
YC84GTAAAGTATGCATAGCTTCGC, from 72 to 52 nt downstream of bla2 stop codonReverse primer for bla2 gene
BLA1-5CATTGCAAGTTGAAGCGAAA, from 98 to 117 nt downstream of bla1 start codonForward primer for RT-PCR of bla1 transcript
BLA1-6TGTCCCGTAACTTCCAGCTC, from −142 to −161 nt upstream of bla1 stop codonReverse primer for RT-PCR of bla1 transcript
BLA2-5TTGTCGATTCTTCTTGGGATG, from 248 to 268 nt downstream of bla2 start codonForward primer for RT-PCR of bla2 transcript
BLA2-6CCCCTACTTCTCCATGACCA, from −39 to −58 nt upstream of bla2 stop codonReverse primer for RT-PCR of bla2 transcript
  • a Restriction enzyme recognition sites are underlined.