TABLE 1.

Primer sequencesa

Analysis and geneSequence
Forward primer (5′-3′)Reverse primer (5′-3′)
pET30b(+) cloning
    groEL1CGGGGTACCTTAAGGAGCGCATCAATGGCGGGGTACCGGCTCGAAGAATCTATTTGTTCC
    groEL2CGGGGTACCTTGTCTAATAGTTTTCGAGACCAAGCGGGGTACCAAATGATCAAGAAATTCTCCTCAG
    groEL3CGGGGTACCTACCCCGCTATGCCTCACCGGGGTACCTCGGTATGATAGGCGGATAG
pBAD24 cloning
    groEL1CGGGGTACCTTTAAGGAGCGCATCAATGGCGGGGTACCGGCTCGAAGAATCTATTTGTTCC
    groEL2CGGGGTACCTTTGTCTAATAGTTTTCGAGACCAAGCGGGGTACCAAATGATCAAGAAATTCTCCTCAG
    groEL3CGGGGTACCATACCCCGCTATGCCTCACCGGGGTACCTCGGTATGATAGGCGGATAG
RT-PCR
    16S rRNACGGTAATACGGAGGGTGCTAGCGAATTAAACCACATGCTCCACTGC
pKPK cloning
    groESCGGAATTCCATGTCAGATCAAGCAACGACCCCGTCGAGTTATTGCAGAACTGCGATAACTT
  • a The specific primers used for RT-PCR of groEL1 to groEL3 were the same as those used for pET30b(+) cloning. 16S rRNA primers were designed in such a way to amplify the 16S rRNA genes of serovar D and biovar MoPn of C. trachomatis, as well as that of C. pneumoniae.