TABLE 1.

Oligonucleotides used in this study

NameaSequencebPurpose
3′.ORF3.XbaI (A)TCTAGAGCCCTATGGATTTAAGAACTGConstruction of pBSV2
ORF3.RC.HindIII (A1)AAGCTTCCTAATCACTAAATTTCTTACConstruction of pOZK-1-3
ORF3.XhoI.stop (B)CTCGAGGCATCATTTAACTAGTAAATTTGGConstruction of pOZK-3Δ
BBC02.HindIII (C)AAGCTTTGCAACATTTTCCTTAATTCATConstruction of pOZK-1-2
BBC01.XbaI (D)TCTAGATTACGATCCAATATCAAGTAGCConstruction of pOZK-1-3 and pOZK-3Δ
9026.XbaI (E)GTCTAGACTTGACTGCTTATTCCGGGTAATTTCConstruction of pOZK-1-2
1p25.15702.XbaI (F)TCTAGAGTTGTATCAAGGGATATTGCCConstruction of pBSV25
1p25.9932.XbaI (G)TCTAGACATCTGCACGATAACCTGTCGConstruction of pBSV25
1p28-1.15748.XbaICCTCTAGAGAGTCCTCTAGTGAGTTGTGCConstruction of pBSV28-1.Aut4
1p28-1.12165.XbaICGTCTAGAGCAAGGGTAAAATAAATTCAAGConstruction of pBSV28-1.Aut4
1p28-1.8292.XbaICCTCTAGAGCGAATTTCTTTTGATGAAConstruction of pBSV28-1.Aut3
1p28-1.5598.XbaIGCTCTAGAGAATCGGAGAAAATGTTTACCConstruction of pBSV28-1.Aut3
  • a Letters in parentheses refer to oligonucleotides indicated in Fig. 4.

  • b Relevant restriction sites are underlined. Bolded letters indicate nucleotides that were altered to produce a stop codon.