TABLE 2.

Oligonucleotides used in this study

Purpose and oligonucleotidesSequenceaLocation and orientationb
Probing intracellular depolymerases
    phaZB-3GTSTAYRTBACXGAYTGGDegenerate oligonucleotides (degeneracy: 192)
    phaZB-4GCRTCGATBGGVCCXSCSATDegenerate oligonucleotides (degeneracy: 288)
Inverse PCR
    phaZC1AAGTGCCCGGCGTCAAGCG5′ phaZ3 core sequence
    phaZC2GCATATCGTGGCGGTTTGCC3′ phaZ3 core sequence
Library screening
    phaZB6GCCGATCAGGTGCTGCACG5′ phaZ2 core sequence
    phaZB10GCGGGATCCCAAATCCCAGGTCCGGTGG3′ phaZ2 core sequence
Generation of deletion strains
    phaZ6CCGGAGGATCCCGCAACAGGTGGCGAC5′ end of region upstream of phaZ1 ORF (+)
    phaZ7CGCAATCGCGGGCGTTTTCGCCTTTTCTGCCTGGGTCTAFusion upstream and downstream of phaZ1 ORF (−)
    phaZ8TAGACCCAGGCAGAAAAGGCGAAAACGCCCGCGATTGCGFusion upstream and downstream of phaZ1 ORF (+)
    phaZ9GCCGAGGATCCGCTGATCAACCCGGTGGTGG3′ end of region downstream of phaZ1 ORF (−)
    phaZD1bCGTGCCAGGCATAAACTGATGGCCCCGGCAGCCGCCAGCFusion upstream and downstream of phaZ2 ORF (−)
    phaZD2cAAAGGATCCCGAAGACAAAGGCAAAGGGGTAG3′ end of region downstream of phaZ2 ORF (−)
    phaZD3bGCTGGCGGCTGCCGGGGCCATCAGTTTATGCCTGGCACGFusion upstream and downstream of phaZ2 ORF (+)
    phaZD4bTTTGGATCCAGCCTTGGGGTGGATTTCATTC5′ end of region upstream of phaZ2 ORF (+)
    phaZC8GCCAAGGCGACGGAGCGCTGCGATTCCCGCCTTTTTGFusion upstream and downstream of phaZ3 ORF (−)
    phaZC9CAAAAAGGCGGGAATCGCAGCGCTCCGTCGCCTTGGCFusion upstream and downstream of phaZ3 ORF (+)
    phaZC10GGCCGGATCCACTTGATTGCAAGCTGCTCC5′ end of region upstream of phaZ3 ORF (+)
    phaZC11GGCCGGATCCTTATTCCGAGCACAAGTGCG3′ end of region downstream of phaZ3 ORF (−)
Deletion strain verification (additional oligonucleotides)
    phaZ2asAATGGCATGTTGATCGTTGGTGUpstream of phaZ2 ORF (−)
    phaZ2seCCTCCTTTACTGCTTGTTGCCGDownstream of phaZ2 ORF (+)
  • a Restriction site (BamHI) engineered into sequences is indicated in bold lettering. Degenerate oligonucleotide code: B = T, C, G; R = A, G; S = C, G; V = A, G, C; X = T, C, A, G; Y = T, C.

  • b Forward (+) or reverse (−) orientation relative to ORF is indicated.