TABLE 2.

Oligonucleotides used in this study

PrimerDescriptionSequence (5′ → 3′)
PCR-1PCR-1:5′ClaI-3′SacI fragments
A-Cla-fConstant forward primer for PCR-1, start is 167 bp in front of YadA start codonTTTTAAAGATCGATTAGTGCTGT
A-87-rReverse, used for YadA-H(NS)-mutants, includes yadA signal sequence plus first 4 aa of yadA: N26-N27-D28-E29 + L introduced by SacITACTGGAGCTCGTCATTATTGGCAAA
A-567-rReverse, used for YadA-N, end: bp 567 (=L189) of yadA, + E-L introduced by SacIGAAGAGCTCAAGGCTTTCATGACCAGGA
A-684-rReverse, used for YadA-S mutants, end: bp 684 (=E228) of yadA + L introduced by SacICGAGAGCTCAGCTGATTTTTTATTTGCAT
A-990-rReverse, used for YadA-L1, end: bp 990 (=Y330) of yadA + E-L introduced by SacIATGGAGCTCGTATTGATTCGATTCACGGATTG
A-1056-rReverse, used for YadA-L2, end: bp 1056 (=G352) of yadA + E-L introduced by SacICCAGAGCTCACCTTTGTCAACTCGTGTGTC
PCR-2PCR-2:5′SacI-3′SphI fragments
A-565-fForward, used for YadA-H, SacI site, start: bp 565 (=L189) of yadAGCTAAGAGCTCAATCGCCAATTGACACATCTTG
A-646-fForward, used for YadA-N, SacI site, start: bp 646 (=E216) of yadAAAGGAGCTCGAAAAAACACAGGAAAATGCAAA
A-733-fForward, used for YadA-HNS1 and YadA-S1, SacI site, start: bp 733 (=L245) of yadATAGTAAAAGTGCTGAGCTCTTGGAAAATGCGCGT
A-778-fForward, used for YadA-HNS2 and YadA-S2, SacI site, start: bp 778 (=L260) of yadATGACCTGTCTAACGAGCTCTTGGATATGCCAAAA
A-868-fForward, used for YadA-HNS3 and YadA-S3, SacI site, start: bp 868 (=L290) of yadAAAAAAATGAGCTGAGCTCTTAGCAAGCGCTAAT
A-990-fForward, used for YadA-HNS4 and YadA-S4, SacI site, start: bp 991 (=T331) of yadAAGACAGAGCTCACAGATCATAAATTCCATCAAC
A-1057-fForward, used for YadA-L1, SacI site, start: bp 1057 (=L353) of yadACGATTGAGCTCTTAGCCAGTTCAGCCGCTTTA
A-1108-fForward, used for YadA-L2, SacI site, start: bp 1108 (=K370) of yadAAAAGAGCTCAAAGATAACTTTCCTGCAGGTG
A-Sph-rConstant reverse primer for PCR-2, end: 569 bp after yadA stop codon, 30 bp after SphI siteGTCAATACAGAGATAGAACAGCT
FLAG-SacI-fConstruction of 30-bp Flag insert dsDNA, deleting a SacI site after insertionGGACTATAAGGACGATGATGACAAACAGCT
FLAG-SacI-rConstruction of 30-bp Flag insert dsDNA, deleting a SacI site after insertionGTTTGTCATCATCGTCCTTATAGTCCAGCT