TABLE 2.

Primers used in this study

Primer nameSequence (5′-3′)
cpxA-R-2GGATGTTTCAATTTCCATGCG
cpxA-R longGTGGTTTACAAG TACGAGAGG
cpx-box-1FGTTGTTTTGAAAGAATTAGAAAGTTTTATTGG
cpx-box-1RCTAATTCTTTCAAAACAACTAATCATACATTAAC
cpx-box-2FGATATATTGAAAGTAAGAGATTTAGCTCAGG
cpx-box-2RCTCTTACTTTCAATATATCAAAATATATCTTTCAA
CpxR-Coli-FACATGCTGCTCAATCATCAGCCCC
CpxR-Coli R2GAATTCATGAATAAAATCCTGTTAGTTG
cpxR-F-2TAAAACAC ATGAAGGACACTGC
cpxR-pET-FGGCATATGAGCAGCTCTATTCTCATTATTG
cpxR-pET-RCCGGATCCTACAGACTACGCATTAAACATGTACCC
icmR-DownATGGGAACCAAGAATTAGGG
icmR-PRO-1FTATATTTTGATAGATGTAAAGTAAGAGATTTAGCTC
icmR-PRO-1RACTTTACATCTATCAAAATATATCTTTCAATATATC
icmR-PRO-2FTATATTTTGATCTATGTAAAGTAAGAGATTTAGCTC
icmR-PRO-2RACTTTACATAGATCAAAATATATCTTTCAATATATC
icmR-reg-upCCCTGGATGAGTTAATGTATG
icmR-UpGAATTCAGGAGTGGTAATAATGGGT
pMC-lacTAAGTTGGGTAACGCCAGGG
rpoE-FTTACTTCAATTAAATCTTGGGGC
rpoE-RCCATTGAAGTGTTCTATCACCG