TABLE 2.

Oligonucleotides used to obtain and analyze the regions of SPI-7 from S. enterica serovars Dublin and Paratyphi C by using PCR fragments

Target DNA covered by PCR oligonucleotide pairsPrimeraPrimer sequence (5′-3′)
phoN-cut3ASB001 (F)GCATATCACTCTGCTTTGCCCGAACTC
SB002 (R)GCCGATACTACGCTGGAAATGGTGGC
tRNApheU region-cut3ADE101 (F)CGCAAAGTGTGCTGGGTCATTCAAAC
DE102 (R)AGGCAGATGGAACTGGTGCTGGAAGG
tviA-tRNApheUDE032 (F)CCAATTCTTTTCTCCAGCGATACATAGTC
DE033 (R)GCTCAGTCGGTAGAGCAGGGGATT
samB-vexEDE076 (F)GCCCTCAAACTGCCGCCATTCCTTAGAC
DE079 (R)GCGACTGTTGCTGACTTAGCCGAG
traC-samACS100 (F)CCACGCCTCTTTATTGCCGAAGCC
CS101 (R)CCATAGCATCCATTCCTGAAGCAC
traG-traCDE063 (F)GAGACCTATGCCGAGAAGTTACTGAC
DE064 (R)CTCAAGCTCACTGCACTGATACTCTC
traG regionDE105 (F)TCAGTGCCCGTTATAATGCAGTCG
DE106 (R)CCGCAGAAGCAACTTCAGAATCTG
pilNa-traGDE065 (F)CAGATGAACCGCCAGGTCAGGCTC
DE066 (R)AGCGTTATTTCCTTCTCCCCCAAG
phoN-pilNaCS104 (F)TTGCCGAAGCAGTAGCGTAGTAGC
CS105 (R)GCTGAATCCAGAATAGATACCGACG
rci-pilR (primers designed to confirm S. enterica serovar Paratyphi C deletion in this region)CS106 (F)GATGTGAACGGAAAAAAACGGGACGCAC
CS107 (R)ATCTCTGATGGTCAGTGGGGACGGGGC
cut3A/tRNApheU-int2 (primers used to analyze S. enterica serovars Typhi and Dublin/Paratyphi C in this region)CS108 (F)TTTTATCCCGACCCAACCCATCCTATTC
CS109 (R)ATCAGTCCTCATCGTTTCAGACACACGC
viaB operon region 1-yjhP (STY4650)-tviDDE028 (F)GCCACACTATTTTCGCCCCTGCCAGGA
DE029 (R)GCTCATCCTGAGAACCCGCCAGACTG
viaB operon region 2-tviD-helD (STY4664)DE026 (F)GCCATGAGTCTGAAGCCAGGAGGAATT
DE027 (R)GCTGGAACCGTCATTCTATCCCGTAGT
samA-samB (primer pair designed to confirm the presence or absence of the SopE phage)DE078 (F)TCCCATAGCATCCATTCCTGAAGCACT
DE079 (R)GCCTCAAACTGCCGCCATTCCTTAGA
  • a F, forward; R, reverse.