TABLE 2.

Primers designed for gene disruptiona

PrimerSequence (5′ → 3′)
H2(−1790)-ATACCCAAGGCTCGGCAAATAACATCTGCTAAATCTTCCATATATTCCT(−1741)CATTCCGGGGATCCGTCGACC
H5(−84)-CCCACAAGTTAAAGTGTCTGATATATCAGGCTCGGAGTGTTATAGAAAA(−135)AGTGTAGGCTGGAGCTGCTTC
H6(+14)-ATTTAGAAACTTGAGCCTGTTAACATAATCAAATTTTCTTTTGTTGTACATAAT(−40)GTGTAGGCTGGAGCTGCTTC
H10(−24)-CTTTTGTTGTACATAATATGTACCTCGTGAGCATATGTAGTGCTCGTTTC(−73)GTGTAGGCTGGAGCTGCTTC
H11(−34)-ACATAATATGTACCTCGTGAGCATATGTAGTGCTCGTTTCATCATGAAA(−83)TGTGTAGGCTGGAGCTGCTTC
H12(−44)-TACCTCGTGAGCATATGTAGTGCTCGTTTCATCATGAAATCCCACAAGT(−93)TGTGTAGGCTGGAGCTGCTTC
H13(−54)-GCATATGTAGTGCTCGTTTCATCATGAAATCCCACAAGTTAAAGTGTCT(−103)GGTGTAGGCTGGAGCTGCTTC
H13-1(−35)-CATAATATGTACCTCGTGAGCATATGTAGTGCTCGTTTCATCATGAAAT(−84)CGTGTAGGCTGGAGCTGCTTC
H13-2(−36)-ATAATATGTACCTCGTGAGCATATGTAGTGCTCGTTTCATCATGAAATC(−85)CGTGTAGGCTGGAGCTGCTTC
H13-3(−37)-TAATATGTACCTCGTGAGCATATGTAGTGCTCGTTTCATCATGAAATCCC(−86)GTGTAGGCTGGAGCTGCTTC
  • a Underlined sequences correspond to the flanking regions of the kanamycin resistance gene of pKD13 (7). Dotted sequences correspond to the sites of the icsB promoter which flank regions to be deleted. The numbers indicate the position relative to the icsB transcription start site at +1.