TABLE 2.

Summary of genes with σB-dependent expression patterns as identified by microarray analyses

CategoryGeneFunction or closest homologuea (E value)Predicted σB promoter sequencebB. subtilis homologuec (E value)Changed (fold)
STOS
Stress lmo2230 Arsenate reductase [Staphylococcus aureus] (le-08) TTTAATGTTTCTAGTAATTTAAAAAGGGTAGATATTACTGT-N108-ATG arsC (7e-10)27.021.9
gadB GadB glutamate decarboxylase (Lmo2434) TGAACGGTTTGTCTCTGTGGTTTAATGGGTATTGGTGAGAGA-N32-ATG 5.34.9
sepA Metallo-beta-lactamase superfamily protein [Shewanella oneidensis] (e-173) CAAAAGGTTTTGAATAATTTTATGGAGGTATAAAAAGAAAGT-N33-ATG 12.013.4
ltrC Low-temperature-requirement C protein CCGTCCGTTTTTAGTTCGTGATGGCGGGGACTATGAACTTAT-N260-ATG† yutG (le-53)‡4.81.9
lmo1433 Glutathione reductase (NADPH) [Methanosarcina acetivorans] (4e-91) TTTTTCGTTTGAAAGTGAAATCAGACGGGAAAACAAGCTAAG-N14-GTG 6.85.7
ctc B. subtilis general stress protein Ctc (le-27) TCCTTTGTTTTGCTATTTTTCTAAAGGGTAGATATAATGTA-N35-ATG ctc (le-33)‡ 1.5 2.2
lmo1602 General stress protein [Oceanobacillus iheyensis] (6e-11) AAGAAAGTTTTAGAGGGGAATACTCAGGGTATAGAAAAAGGA-N18-ATG ytxG (6e-13)‡2.72.1
Virulence and virulence associated bsh Bsh bile salt hydrolase (Lmo2067) AATTATGTTTTACTCCAAACTCCGAGGGTACTGGTATACAT-N31-ATG 10.820.1
inlA Internalin A CCATTAGTGTTATTTTGAACATAAAGGGTAGAGGATAACAT-N437-GTG† 6.2 3.9
inlB Internalin B CCTTTTGTTAGGGTTATTAGCAGTAGGAACTGCAATGGCTC-N113-GTG† 4.6 2.1
inlC2 Internalin C2 TTTTTTGTTAATTTGGTCTAAAAAAGGGTATCTATTATTAA-N55-ATG† 11.4 7.3
inlD Internalin D None found 3.3 2.3
inlE Internalin E TAAATCGTTAACAAGTCTAATTTTAGTGATTAAACGAAATC-N84-ATG† 3.72.4
Transporters opuC operon TAAAAAGTTTAAATCTATACTAGTTAGGGAAATTAGTTATCG-N48-GTG
    opuCAGlycine betaine/carnitine/choline ABC transporter (ATP-binding protein) opuCA (e-159)5.36.5
    opuCBGlycine betaine/carnitine/choline ABC transporter (membrane protein) opuCB (le-74)3.84.7
    opuCCGlycine betaine/carnitine/choline ABC transporter (osmoprotectant-binding) opuCC (le-92)4.15.2
    opuCDBetaine/carnitine/choline ABC transporter (membrane protein) opuCD (5e-66)5.05.8
lmo0784 PTS enzyme IIAB, mannose-specific [Yersinia pestis KIM] (5e-34) AATTGCGTTTTCTGACTAATCTTTTAGGGTAATGTTGTATGT-N195-ATG levD (le-21)7.55.0
lmo2602 Cation-transporting ATPase [Oceanobacillus iheyensis] (2e-12) TTGATTGTTTTGGTTTAATGCCAAAGGGAATATATTAACGT-N16-ATG sapB (le-09)5.53.8
lmo0405 PHO4, phosphate transporter family [Bacillus anthracis] (4e-76) GATTCTTTTTATATTTGTATAAAAGGGGTATAGACAATAAA-N30-ATG 3.9 4.9
lmo2463 Probable export protein (antibiotic) [Streptomyces coelicolor] (6e-80) AATGATGTTTGGCATATGTAAAAAAGAGGTATAAATTAGCGTG ydfJ (4e-30)3.05.2
lmo1539 Glycerol uptake facilitator [Bacillus halodurans] (8e-66) AAATGGGTTATAACTCTCGCGAATTGGGGTAAAAGTAAAGAG-N254-ATG glpF (5e-81) 2.4 2.3
lmo1421 ABC transporter [Bacillus anthracis A2012] (8e-98) AATTAGGAATATTTAGGGATGATTTAGGGTAATTGGATGATA-N74-ATG† 2.52.1
lmo0524 Sulfate transporter [Mycobacterium tuberculosis CDC1551] (2e-50) AGAGATGATTGTTCTATGTCAAAACGGGTAAATAGTATAAG-N65-ATG 2.02.9
lmo0593 Formate/nitrite transporter family protein [Streptococcus agalactiae] (7e-37) TTTTGTGTTTTAAGAGTTTGAAAACGGGGAAATTAACAACAT-N146-TTG ywcJ (le-18)2.92.3
Metabolism lmo0669 Oxidoreductase [Oceanobacillus iheyensis] (3e-86) TTAAACGTTTTAGCGTAAAACAGGAGGGAAGACATAAAGTA-N139-ATG yhxD (3e-95)‡14.29.5
lmo1694 Epimerase, NAD-dependent family [Bacillus anthracis] (2e-62) AAAATGGTTTTAATACTACTAAAAAGGGAATAAACTAGTTA-N22-TTG yfhF (5e-59)‡11.511.7
lmo1883 Chitinase [Serratia marcescens] (e-117) TTTCTAGTTTTATTTTCACTATGTTGGGTATTTTCTAGTAG-N47-ATG 4.12.1
lmo2695 Dihydroxyacetone kinase [Bacillus halodurans] (e-103) AACCACGTTTTGACTTTCTAGTAAAGGGAAATTGAGGTAAG-N30-ATG 2.84.3
lmo0956 N-Acetylglucosamine-6-phosphate deacetylase [Bacillus anthracis] (e-110) TTTTTTGGTTATTTTACTTTTTTTCGGGTAAATAGGAAAAG-N71-ATG nagA (le-72)1.8 1.4
lmo2205 Phosphoglycerate mutase [Neisseria meningitidis] (4e-86) AAAAAGGTTTGACACTTCACTTGAAAGGGAAAACTTTGGTTG-N44-ATG 1.8 3.2
pdhA Pyruvate dehydrogenase (E1 alpha subunit) [Bacillus subtilis] (e-151) ACCCATGTTTTCAATGAGGAATTTGTGGTAATAACTGGAGAG-N231-ATG pdhA (e-162)1.71.6
lmo1933 GTP cyclohydrolase I [Bacillus halodurans] (6e-67) TTAGTGGTTTTCTGTTTTAGAAATAGGGAATATAATTACGA-N113-ATG mtrA (7e-73)‡ 2.0 2.0
Transcriptional regulation rsbV operon TTGAATGTTTTAATTTTATTTGTTAGGGTAAAATCGACAGT-N27-ATG†
    rsbVAnti-anti-sigma factor (antagonist of RsbW) rsbV (3e-24)‡ 2.1 2.0
    rsbWSigma B activity negative regulator RsbW rsbW (3e-42)‡2.02.4
    sigBRNA polymerase sigma-37 factor (sigma B) sigB (7e-97)‡2.22.3
    rsbXIndirect negative regulation of sigma B (serine phosphatase) rsbX (le-26)‡2.02.2
lmo2485 Transcriptional regulator [Methanosarcina mazei Goel] (le-04) GCAAAAGTAGGAAATGGAATTATCAAGGTTTCTGAACTCGA-N42-ATG 1.83.9
Cell wall lmo2085 Surface-anchored protein (LPXTG motif) [Listeria innocua] (le-18) CTGGCTGTTTTCTTTTGCTGTTTTATGGGTATTTAATGATGT-N28-ATG 14.710.7
lmo0880 Surface-anchored protein (LPXTG motif) [Listeria innocua] (le-26) TGTACGGTTTTTAACAAGCAAGTTGTGGGAACCTATAAAGATA-N26-ATG 5.2 2.1
Energy qoxA AA3-600 quinol oxidase subunit II TTTTTTGTTTCGAATTTCACAATCTAGGGAATAGTGAACAGA-N265-GTG qoxA (3e-91) 1.5 1.9
lmo2389 Pyridine nucleotide-disulfide oxidoreductase [Bacillus anthracis] (e-123) GATATAGTTTGTAAGCTGTGAAATAGGGAATATATTGGTAC-N127-ATG yumB (e-128)‡ 1.6 3.4
Translation lmo1698 Ribosomal protein (S5)-alanine N-acetyltransferase [Bacillus halodurans] (3e-) TGGAAAGTTTATTTTTTAATAAAATGGGTATATAGAAAAAT-N72-ATG yjcK (3e-55)3.11.9
lmo2511 Ribosomal_S30, sigma 54 modulation protein [Bacillus anthracis] (2e-53) AAAGAGGTTTGCGGAAGCGGTATTAGTGGAATAAAATACTAA-N135-ATG yvyD (e-162)‡3.81.9
DNA translocase lmo1606 DNA translocase (spoIIIE) [Bacillus halodurans] (e-168) TACCATGTTTAACCCCTCTATTACCAAGGTATTATAACGAAT-N97-ATG ytpT (0.0)2.42.6
Hypothetical lmo2570 Hypothetical protein YvaZ [Bacillus subtilis] (.023) CAACAGGTGTTCTAGAATATTTACGGGAACAAAAAGTCGA-N234-ATG yvaZ (5e-09)5.35.9
lmo2269 YhzC of Listria monocytogenes (9e-26) TTTTAAGATTGTAATAAATATGAGTGAAGGAGTGGTAGTCGTG 4.0 5.3
lmo0911 BH2119-unknown [Bacillus halodurans] (le-06) CATCTTGTTTTAACTTGCCCTCAGGCGGGTATTTATTATATG-N53-ATG 2.21.9
lmo0794 Conserved hypothetical protein YwnB [Bacillus subtilis] (2e-50) ATAAATGTTTCCCAGTCCCCTCTTTCGGGAATAATTCTTCTA-N45-ATG ywnB (5e-54)5.25.8
lmo1580 Conserved hypothetical ATP-binding domain [Bacillus anthracis] (2e-40) TTTTATGGTTCTTTTAGGAAAAAGAGGGTAAAATATAAGTA-N35-ATG yxiE (4e-11) 2.0 2.7
lmo2673 Conserved hypothetical ATP-binding domain [Bacillus anthracis] (4e-28) AATCATGCTTCTTTCTTTTATTTATGGGTATTAAGTAAATA-N30-ATG 3.76.9
lmo2386 Conserved hypothetical protein YuiD [Bacillus subtilis] (le-37) GAATAGGTTTTTAATAAGCTCATTGTGGTAAAATAAGAATAG-N22-ATG yuiD (le-50) 1.8 2.4
lmo2399 Hemolysin homolog YhdP [Bacillus subtilis] (2e-89) CTTGTGGTTTAAACGCTAAGAACGGGTATAGAATGGGGA-N15-ATG 2.0 2.5
lmo0438 No similarity ACTAACGAATCGCGTGGATGCGCTTCGGGAATTGTTGAAATA-N157-GTG 2.7 3.4
lmo0994 No similarity GAAAGAGGTTATTTTTCACTAAATGGGGTAAAAATACGTTA-N257-ATG 6.16.5
  • a The function of the protein encoded is listed if it has been supported by genetic or biochemical data. Otherwise, the nearest homologue of the protein with known function is listed. The E values in parentheses were obtained with Blast 2.0 searches with the BLOSUM62 matrix against the nr database. PTS, phosphotransferase system.

  • b The promoter sequence as predicted by HMM is listed. For genes without an HMM-predicted promoter sequence (marked with †), a putative promoter identified by visual inspection is indicated; “none found” indicates that no suitable promoter could be found by HMM or visual inspection. The expected −35 and −10 regions are in bold, and the last nucleotide triplet is the presumed translational start codon.

  • c The B. subtilis genome was searched for ORFs encoding proteins homologous to the given L. monocytogenes protein by Blast 2.0 on the SubtiList web server (http://genolist.pasteur.fr/SubtiList ). The closest homologue is listed, if one was found, along with the E value in parentheses. Homologues that have been determined to beσ B dependent in B. subtilis (51, 53) are marked with‡ .

  • d Change was calculated with SAM based on microarray data (see the text) and equals the average wild-type spot intensity divided by the average mutant spot intensity for two separate arrays from each of two replicate RNA isolations. Numbers in italics indicate ratios that were determined by SAM to not be statistically significantly different from a ratio of 1.0. ST, stationary-phase cells; OS, osmotically stressed cells (0.5 M KCl).