TABLE 2.

Oligonucleotides used for PCR and primer extension analysis

DescriptionBasisaNamebPrimer sequence
Probe 1 AJ556795 sae285UCAAATTGAAGAAATGAGGAGTTA
sae564LACCTTTTGATGATTTGTAGTTAG
Probe 2 AJ556795 sae727UTTCGGCGGCGCTAAATTAAA
sae981LTGCTTAAGCTAAACAAACCTC
Probe 3 AJ556795 sae992UTCAAACACTTCCTGTTCACA
sae1283LTGACGTCGTATGTGCAACTA
Probe 4 AJ556795 sae1980UTGGTCACGAAGTCCCTATGC
sae2458LTGCTTGCGTAATTTCCGTTAG
Probe 5 AJ556795 sae3364UAAACTTTATGGGTATCCTTCTCA
csbLTTGGCTTGTTTATCTTTTCAATA
fnbA probe J04151 fnbAUTGCAAATACGACAGATACTT
fnbALTTGGCCACCTTCATAACCTA
coa probe X16457 coaUCGAGACCAAGATTCAACAAG
coaLAAAGAAAACCACTCACATCA
agr probe X52543 RNAIIIUTATATTTTAACGGCGGGTCTCA
RNAIIILTTAATTAAGGAAGGAGTGATTT
hla probe X01645 hlaUAGAAAATGGCATGCACAAAAA
hlalTGTAGCGAAGTCTGGTGAAAA
Tn917 probe M11180 Tn917UTAAGAGTGTGTTGATAG
Tn917LACGATAAGTTGAATAGATAG
sae cloning AJ556795 sae1UTTATTGTGGCAAAAGGTTTAT
sae3530LATTATTAGGCGGCATACAG
Primer extension 1 (P1) AJ556795 sae337, CY5ACCTAAAGCTAATGTTGTGATAACAGCACC
Primer extension 2 (P1, P2) AJ556795 sae1017, CY5TAAGATTAAGCAACATAATGCGATTTGTAG
Primer extension 3 (P2) AJ556795 sae1290, CY5CAATCTCTCCGAGTGGGACAACAATATC
Primer extension 5 (P2, P3) AJ556795 sae1772, CY5GTATCATGTTCTTGTGTTTTGGCAGTTA
Primer extension 6 (P3) AJ556795 sae1973, CY5TACGCATAGGGACTTCGTGACCATTTACAG
  • a GenBank accession number.

  • b Numbers indicate nucleotide position in the corresponding reference sequence. U, upper primer; L, lower primer.