TABLE 1.

Oligonucleotides used in this study

Gene (locus in S. aureus COL)Primer sequence (5′→3′)a
adh (SA0660)CAGTTGTAACGAAAGATCAC
CTAATACGACTCACTATAGGGAGACATCAAGCACTAATCTTGGG
arcB (SA2656)CCGTATGATTTAAAAGGCAG
CTAATACGACTCACTATAGGGAGATTTGTATCATGGAATGCTGG
citB (SA1385)GGCTGCAAATTTTAAAGAGC
CTAATACGACTCACTATAGGGAGAGCTAGTGGTAAATGTTGTAC
fba (SA2117)GGAAAAGGCTTTATTGCCGC
CTAATACGACTCACTATAGGGAGAATGCGTCGTAGATTGATTC
gap (SA0838)GTTTCACAGGTGAAGTAGAGG
CTAATACGACTCACTATAGGGAGAACACGAGTTTGTGTAGCGTC
ldh (SA0222)CATGCCACACCATATTCTCC
CTAATACGACTCACTATAGGGAGATCTGCTTCAGCCATAATATC
pflB (SA0204)CATGCAACAGCTTGGCAAGG
CTAATACGACTCACTATAGGGAGACCTGCTTTAAGGTCACGTTT
RNAIIIAGGAAGGAGTGATTTCAATG
CTAATACGACTCACTATAGGGAGAACTCATCCCTTCTTCATTAC
  • a The underlined sequences are the recognition sequence for T7 RNA polymerase.