TABLE 2.

Primers used in this study

Primer for PCR and sequencingSequence (5′-3′)Position of the 5′ nucleotide
parE primersa
    GRLB1CGCCGATAAGATAACTTAGTACTA137
    GRLB1RGCTCTTGACGCTCTTTACCAC1036
    GRLB2TAAGTGAACGACTACAAGAGTCTGC947
    GRLB2RACCTCCCGCAGAATCACCTTC1692
    GRLB3GCAAGGGAAGCTGCACGTAAAGC1537
    GRLB3RGGCAATGCACGCTCTTGAATA2470
parC primersa
    GRLA1AGTTGAAGATGAAGTGCGTT2196
    GRLA1RACCTTGAATAATACCACCAG3041
    GRLA2GCTGAAGAGTTATTACGTGA2757
    GRLA2RACGCAAGATACCGTACTAGTA4028
    GRLA3GTTATGGTGCCTAGTGAAGAA3861
    GRLA3RTAACGATAAGTACTTGGTCAGC4881
Primers for upstream region of gyrBb
    UPGB1AGGTGACGACTCGGTAACGC1,793 bp upstream of start site of gyrB
    UPGB1RAGGATATTCACGTCAGGATGACAT1,039 bp upstream of start site of gyrB
    UPGB2TATCCCAGAATTACCTGAAGATG1,178 bp upstream of start site of gyrB
    UPGB2RATAGGATCGACTTCAGAGAGAG127 bp downstream of start site of gyrB
gyrB primersc
    GYRB1TAGACGATGTACTCAGTGAAT2
    GYRB1RGTGGCATATCCTGAGTTATAT1004
    GYRB2CTATCACTATGAGGGCGGTA858
    GYRB2RGCACGAGCAACGATAACACTC2252
gyrA primers
    GYRA1CCTCAATCAAGAATAAATGAACGA2164
    GYRA1RTATCACGTAACAGTTCAAGTGT2566
    GYRA2GGTTCAATGGATGGAGATGG2482
    GYRA2RCTGTATCTGACTCACGAATC3361
    GYRA3CGTACTGGTGTGCGTGTCGTT3046
    GYRA3RCTGGCGTACGTTTACCATAAC4336
    GYRA4CAACGGGTGTGAAAGGTAT4211
    GYRA4RGCCACCATCAAGACTTATC5027 (8)
norA promoter primersd
    DMBL3CAATGCCGCTGACAGATGTA27
    DMBR3TTGTCAGCTAGCGTACCACCAA550
Primers for upstream region of topBe
    UPTB1GTTATGGCTGATATAGGTGGTG3,085 bp upstream of start site of topB
    UPTB1RCAAAACGCAATAACACATCATGAC2,259 bp upstream of start site of topB
    UPTB2GGGCTTTTATTTATGACATAGTTG2,446 bp upstream of start site of topB
    UPTB2RACTTGTTCATGTTCTATTCTCA1,922 bp upstream of start site of topB
    UPTB3GACGACGATCTTTTCTTTCTCC2,047 bp upstream of start site of topB
    UPTB3RGGGGAGCACTTGCAAAAATA1,215 bp upstream of start site of topB
    UPTB4CGTCGTACCACGAATT1,368 bp upstream of start site of topB
    UPTB4RAGGCATTCAACAATACAAACCA528 bp upstream of start site of topB
    UPTB5TGTAATTTGCTGAAAGCACGA686 bp upstream of start site of topB
    UPTB5RCTAACGCCCACGTGACAATA122 bp downstream of start site of topB
parE probe primersa
    GLBPCAGGTTTTAGAGGGGTTAGAA421
    GLBPRTGTCGGTTTACCTGATTTATG654
parC probe primersa
    GRLAPGATACGACACTCGAACCAAT2817
    GRLA1RACCTTGAATAATACCACCAG
gyrB probe primersc
    GYBPCTATCACTATGAGGGCGGTATTA858
    GYBPRGTATCTTCACCAGAAAGTCTATC1124
gyrA probe primers
    GYRA3CGTACTGGTGTGCGTGTCGTT
    GYRA2RCTGTATCTGACTCACGAATC
topA probe primersb
    TOPAPGCGTAATCCAGCAAACCCATT747 bp from start site
    TOPAPRCACCTTGTTTCCCTGATGCTTT1018 bp from start site
topB probe primersb
    TOPB3AAGCCAATCCGTCGATTATG370 bp from start site
    TOPB3RCGTTCCTGTCTGAACACGTC582 bp from start site
  • a Data were obtained from the sequence of Yamagishi et al. (52).

  • b Data were obtained from the sequences of Baba et al. (4) and Kuroda et al. (32).

  • c Data were obtained from the sequence of Ito et al. (25).

  • d Data were obtained from the sequence of Yoshida et al. (53).

  • e Data were obtained from the sequence of Baba et al. (4).