TABLE 1.

Oligonucleotide primers used in this study

NameSequence (5′ → 3′)aLocalizationUnderlined sequence
SosATCCTGCAGGTCGACTTTTTAACAAthl promoterSalI restriction site
SosBATTGTTATCCGCTCACAATTCAACTTAATTATACCCACTATTATTATTTTlac operator 1
SosDATTGTGAGCGGATAACAATTTTAGAGAAAACGTATAAATTAGGGATAAACTATGGAlac operator 1
SosETAAATTCTGGATCCTACGGGGTAACAGAthl promoterBamHI restriction site
LacD2TCGATCTAGAAATTGTGAGCGGATAACAATTAAAGCTCCTGCAGGlac operator 2SalI extension
LacR2TCGACCTGCAGGAGCTTTAATTGTTATCCGCTCACAATTTCTAGAlac operator 2SalI extension
CipC1DGGGGATCCAGAATTTAAAAGGAGGGATTAAAATGCGTAAAAAGTCTTTAGCAcipC1BamHI restriction site
CipC1RTTCCGGCGCCTTATACTGCTACTTTAAGTTCCTTTGcipC1NarI restriction site
MutB-DCAGCTGGAGGTTCCATAGAGATBamHI mutation in cipC1
MutB-RATCTCTATGGAACCTCCAGCTGBamHI mutation in cipC1
rMC1SOS1GGTGGGGGATCCTTCGAACTACTCGAGTTCCTTTGTAGGTTGAGTACCUsed for construction of scaf3BamHI, AsuII, XhoI restriction sites
  • a lac operator sequences are italicized; stop codons are in boldface.