TABLE 2.

Primersa

PrimerSequence (5′→3′)Position (range)
NHP-FORCGCGAAGCTTGCACAGCATGAACAAGA2977568 to 2977552
NHP-REVCGCGGATCCTGCACATCAACAATTCTC2976948 to 2976965
NHR-FORCGCGAAGCTTGGAAAGCAGAGGAACAC2976737 to 2976721
NHR-REVCGCGGATCCAATGCTTGACAATCGCTA2975208 to 2975225
PE-FORCGCGGATCCACAGACTATGAAAGAGCG2977844 to 2977827
PE-REVCCGGAATTCAAGCATCACATCAAGCAC2977394 to 2977411
PEPH1GATTCTTCATCATCCACAACTA2977524 to 2977545
PEPH2GTAATGACATCATAGCCTGACC2977470 to 2977491
PP-FORTCATCATGAACAAGAAAATTTTAGTTGTGGATGATGAAG2977557 to 2977528
PP-REVCTCCTCGAGTTCATTCATTTTTGGCTCCTCCAGTTTATACC2976842 to 2976873
R231-FORGGTGGTCTCCCATGCAGCGGGATCGGCTGCTGAC2976156 to 2976134
R231-REVCTCCTCGAGGGCGGACTTTTCAGCGGCCCGTTTCAG2975110 to 2975136
PhoP-FORGAGAGAAAGGCTTGCTTAATAC2977766 to 2977745
PhoP-REVAAATTTTCTTGTTCATGCTGTG2977546 to 2977567
YhaX-FORTAACGATATTAGGGAGAATGGC1055846 to 1055867
YhaX-REVGAAGCAGCGCTCCATCTATATT1056056 to 1056035
YkoL-FORTGAAATGCTGGAGACGTTTATG1397308 to 1397329
YkoL-REVTTTTCTAAAGCGGATTTCAATA1397520 to 1397499
  • a Positions of the primers specific for B. subtilis 168 are with respect to the entire genome as noted in the SubtiList database (http://genolist.pasteur.fr/SubtiList) (20). The 5′ ends of primers included a 9- or a 10-bp linker with a BamHI, BsaI, BspHI, EcoRI, XhoI, or HindIII restriction site (underlined).