TABLE 2.

Oligonucleotides used for construction and verification of deletion strains

OligonucleotideOligonucleotide sequence (5′ to 3′)
acrA-NoCGCGGATCCATTCGCATTTGTGGAATATAATCTCCATCA
acrA-NiCACGCAATAACCTTCACACTCCAAATTTATAACCATATGTAAACCTCGAGTGTCCG
acrB-CiGTTATAAATTTGGAGTGTGAAGGTTATTGCGTGTGATACAACGTGTAATCACTAAGGCC
acrB-CoCGCGGATCCATGGAAAAAACTTACTGACCTGGAC
emrK-NoCGCGGATCCTGGATACCGTTAACTCCGGGG
emrK-NiCACGCAATAACCTTCACACTCCAAATTTATAACCACTATTATCTCTCATTTCTCATAGAT
emrY-CiGTTATAAATTTGGAGTGTGAAGGTTATTGCGTGTGATGATAAAAGGAGGGGGTTATAGCG
emrY-CoCGCGGATCCTGTTGGCGGTGGTCCTGGTGG
mdtE-NoCGCGGATCCCAGTTCAAAATTATGCAACTGATTCTG
mdtE-NiCACGCAATAACCTTCACACTCCAAATTTATAACCATTTTAGTCCCTGAAAATTCTTGAG
mdtF-CiGTTATAAATTTGGAGTGTGAAGGTTATTGCGTGTAACGTGTAAATGAGAGTAAGGTTGA
mdtF-CoCGCGGATCCCGTCAAATTCCTCTGCATACTATTGC
acrE-NoCGCGGATCCCGTCGTCTTGCTTACGCCAT
acrE-NiCACGCAATAACCTTCACACTCCAAATTTATAACCATTACTATTCCTCAAAAAACCAAAAG
acrF-CiGTTATAAATTTGGAGTGTGAAGGTTATTGCGTGTAAATCAGAAACATAAAGGCGCTTTCG
acrF-CoCGCGGATCCCGTCGTCTTGCTTACGCCAT
tolC-NoCGCGGATCCTCATCCCGGCAACCATCTC
tolC-NiCACGCAATAACCTTCACACTCCAAATTTATAACCATTCCTTGTGGTGAAGCAGTAT
tolC-CiGTTATAAATTTGGAGTGTGAAGGTTATTGCGTGTGATGACGACGACGGGG
tolC-CoCGCGGATCCGCTGGATTGCTGGGCC
hns-NoCGCGGATCCCTCCCTTACGAAGCCTTGCATAATCC
hns-NiCACGCAATAACCTTCACACTCCAAATTTATAACCATTGTAGTAATCTCAAACTTATAT
hns-CiGTTATAAATTTGGAGTGTGAAGGTTATTGCGTGTAATCTTTTGTAGATTGCACTTGC
hns-CoCGCGGATCCGTTGAATTAGCGCCGGGTGAAAGCGTAC
evgA-NoCGCGGATCCGAAAACGCAATAAATAAAACTACCGCC
evgA-NiCACGCAATAACCTTCACACTCCAAATTTATAACCATAGATTATTCCCTTTGCAATGA
evgS-CiGTTATAAATTTGGAGTGTGAAGGTTATTGCGTGTAAATAGCGGCTCCCACAATGTTC
evgS-CoCGCGGATCCCATGGCACCTTTTGATGTTTTCAATACT
ydeO-NoCGCGGATCCTATTCCGGTTGAATTAGAACC
ydeO-NiCACGCAATAACCTTCACACTCCAAATTTATAACCATTTTATCTCCTTAAAACAATAAAGT
ydeO-CiGTTATAAATTTGGAGTGTGAAGGTTATTGCGTGTGATTATTTGCTAACGAGTAGTCAACC
ydeO-CoCGCGGATCCGTCGGCGTAAAGTCTGAGAAA