TABLE 2

Primers used in this study

NameSequence (5′–3′)Application
5′SpxA1pET-16BAGGGGTAGTCATATGATGGTTACCHis-SpxA1 express
3′SpxA1pET16BGGGTAAGCGCTCGAGTTAGTCATCTTCHis-SpxA1 express
5′SpxA2pET16BGAAAGAGAGATCATATGATGATTAAAATTTAHis-SpxA2 express
3′SpxA2pET16BTCATTACTTCGACTCGAGTTATAAAGCTGCHis-SpxA2 express
5′pET16BBamHITTGTTTAACTGGATCCGGAGATATACCATGRelease His-tag Spx
3′pET16BXhoICGGGCTTTGTCTGCAACRelease His-tag Spx
5′spxA1pMALAAGGGGTAGTGAATTCATGGTTACCMBP-SpxA1 express
3′spxA1pMALGGGTAAGCGGGATCCTTAGTCATCTTCMBP-SpxA1 express
5′A1G52R-PCR1CTTTCCAGAGTCTCCTCAATTAGCspxA1 G52R mutation
3′A1G52R-PCR1GTCGAAATAATATCTTCTGTGCGGTTTTCTGTATAGGspxA1 G52R mutation
5′A1G52R-PCR2CCTATACAGAAACCGCACAGAAGATATTATTTCGACspxA1 G52R mutation
3′A1G52R-PCR2GGTTTGACGACCGAAATCGGCspxA1 G52R mutation
5′A2G52R-PCR1GCAGGGAAATTGATTGATTCTGGCGCspxA2 G52R mutation
5′A2G52R-PCR1GCAGGGAAATTGATTGATTCTGGCGCspxA2 G52R mutation
3′A2G52R-PCR1GGATACAATGCTTTCAATACGATTTTCTGTTTTTGspxA2 G52R mutation
5′A2G52R-PCR2CAAAAACAGAAAATCGTATTGAAAGCATTGTATCCspxA2 G52R mutation
3′A2G52R-PCR2CAACATCATACTATAGTTATAGTACAAGCspxA2 G52R mutation
sodART FwdGATGCTGAAACGATGACCCTTCqRT-PCR, sodA
sodART RevCACATCAGCCAAAAGCACTTCCqRT-PCR, sodA
tpxRT FwdCTCCATCTGCTTGGACGTGCTGqRT-PCR, tpx
tpxRT RevGCAAGGGCAGCGTCATAGTTGqRT-PCR, tpx
ahpCRT FwdATGGTTTAGCACAACGTCGAACqRT-PCR, ahpC
ahpCRT RevTTGGCAGGGCAAACTTCTCCqRT-PCR, ahpC
gorRT FwdACCTGTAATGTTGGCTGTGqRT-PCR, gor
gorRT RevCCTGACGATTTTGCTTCAAGACqRT-PCR, gor
noxRT FwdGGGTTGTGGAATGGCACTTTGGqRT-PCR, nox
noxRT RevCAATGGCTGTCACTGGCGATTCqRT-PCR, nox
dprRT FwdGAAGAAACAGTTGGCACATGGGqRT-PCR, dpr
dprRT RevTTCCGTTTGAGCTGCTGTAAAGqRT-PCR, dpr
trxART FwdTTGAAGCTGAAACGGCTAAGGGqRT-PCR, trxA
trxART RevGCCTGCATAAGACATGGACCACqRT-PCR, trxA
trxBRT FwdAGTTGTTGGTGGTGGCGATTCqRT-PCR, trxB1
trxBRT RevCATTGGCAAAGGCACGTTCTTGqRT-PCR, trxB1
trxB2RT FwdGGAGAGGCACCAACAGCAGqRT-PCR, trxB2
trxB2RT RevATGATGTGGAATGAACGACACGqRT-PCR, trxB2
5′IVTsodAGCTATTAAGAGCGGGACTTACIVT, sodA
3′sodAGCATGATGCTTATCATGATGIVT, sodA
5′tpxGAGTGGTCAAAAAATAAACATATTTTTATTGIVT, tpx
3′tpxCTGTCAGAGAAAAATCAGGTGCTGTATCIVT, tpx
5′ahpCCTCTTTTGTTTTATGCTTCAAATTTTATTTTTAGIVT, ahpC
3′ahpCGTTAACCGTAACAAATTCTCCTTGATGIVT, ahpC
5′mleSGAATACAAGTTTAAAAGCAAATAGTTAACIVT, mleS
3′mleSGGCAAAAGACCAATAAGTCCIVT, mleS