TABLE 1.

Plasmids and primers used in this studya

Plasmid or primerDescriptionbReference
Plasmids
    pT7BlueColE1 ori; AprNovagen
    pHP45ΩkanPlasmid carrying Kmr cassette with transcriptional terminators at each end; Apr Kmr8
    pCP11E. coli-F. johnsoniae shuttle plasmid; Apr (Emr)25
    pCP23E. coli-F. johnsoniae shuttle plasmid; Apr (Tcr)1
    pCP26E. coli-F. johnsoniae shuttle cosmid; Kmr Tcr (Emr)20
    pCP500Cosmid clone carrying gldI; Tcr (Emr)This study
    pCP507Cosmid clone carrying gldI; Tcr (Emr)This study
    pMM2586.3-kbp SacI fragment of pCP500 (spanning ppiB, fjo20, and fjo21) in pCP11; Apr Tcr (Emr)This study
    pMM2596.6-kbp SacI fragment of pCP507 (spanning fjo19 and gldI) in pCP11; Apr Tcr (Emr)This study
    pMM2682.3-kbp EcoRI-EcoRV fragment of pMM259 (spanning fjo19) in pCP11; Apr (Emr)This study
    pMM2911,032-bp fragment spanning gldI in pCP11; Apr (Emr)This study
    pMM292Identical to pMM291 except that gldI is inserted in the opposite orientation; Apr (Emr)This study
    pMM296pMM291 with the Kmr cassette from pHP45Ωkan inserted upstream of gldI; Apr Kmr (Emr)This study
    pMM297Identical to pMM296 except that the Kmr cassette is inserted in the opposite orientation; Apr Kmr (Emr)This study
    pTB39Recombinant gldB-his in pCP23; expresses GldI with a carboxy-terminal His tag; Apr (Tcr)24
    pTB45Recombinant gldI-his in pCP23; expresses GldI with a carboxy-terminal His tag; Apr (Tcr)This study
Primers
    4595′ GAATAAAACGAGCTAACGGC 3′; primer used for construction of gldI-containing plasmids pMM291 and pMM292
    4765′ TCTTACATGACTTTGACTCAGG 3′; primer used for construction of gldI-containing plasmids and pTB45
    5745′ TTATTAATGATGATGATGATGATGATGATGTGGGTTTAATGTATCTTTTTTAGTTTGAGCTGC 3′; primer used during construction of pTB45
  • a Antibiotic resistance phenotypes are indicated as follows: Apr, ampicillin resistance; Emr, erythromycin resistance; Kmr, kanamycin resistance; Tcr, tetracycline resistance. Unless indicated otherwise, antibiotic resistance phenotypes are those expressed in E. coli. Antibiotic resistance phenotypes listed in parentheses are those expressed in F. johnsoniae but not in E. coli.

  • b For primers, both the sequence and description are given.