TABLE 1.

Primers used for RT-PCR

GeneForward primerReverse primerTemp for PCR (°C)aLength (bp)b
flaACATGATGCAAACATCGATCGACTGCTACTTCTGTTCCTGTTG52480
fliAAACGCATTGCACATCATCTGCATAAGACATCATCGGTTACTC50400
fleNTAGCCATAGCGTTATCTCAACGTAATCTAACTGCACATCCAG52540
fleQGTGACAAGCTTCGGACTATTTGAAAGAGAATGTATATTGCGA50490
rpoNTGGTCAACATCTCACGTTAACCCTAGCAACTCAATGTCTTCA51600
fliMGAGATCGATGCATTACTGGATTAATAATCGACCAAGTCATACACA51450
icmRATACTGATGACAGTGCACGAAGATGATAATTTGAAACCACGTTC50350
flesRAAGTATATCGATATGGAGTTTAACTATTAAAACATGACTCAT45480
  • a Temperature used for the amplification step in the RT-PCR.

  • b Length of amplified template.