TABLE 1.

Primers used for reporter gene fusions and mutagenesis

PrimerDNA sequence (5′ → 3′) with incorporated restriction site underlinedApplicationAccession no.
spaP5′ATGGATCCAGCAAAAATTGACAAATCAAATCspaP promoterX17390
spaP3′TTCTGCAGCATAAATCCTCCAAATCTGAATAAATC
gbpB5′TAGGATCCTATGAAAGGCGATGTTAAAGCgbpB promoterAY046410
gbpB3′TTCTGCAGATATAACTCCTTTTTCGATAAGAC
gtfB5′TAGGATCCGACAATTGTGGTGGGTACgtfB promoterM17361
gtfB3′TACTGCAGCTTGTCCATTAGGAACCTCC
gtfC5′ATGGATCCGATGCTAACTCTGGAGAACGgtfC promoterM17361
gtfC3′ATCTGCAGTCCAAAAATAGTTAGAGTTAGTG
ftf5′GGGGATCCTAGCTAGTGGACAGACTCTGftf promoterM18954
ftf3′AACTGCAGTTTCCATTAGCAAACCTCC
fruA5′TTGGATCCGAGCATTAATGACATCTGTCATATTAAGfruA promoterU78296
fruA3′ATCTGCAGTTTTCAAATTTATGAAACTGACAAACTC
up5′CAACATCAAGCGAAGCCTCGAC5′ region of smu486AE014133
up3′TTGAGCTCCATATACGTTCTACCTCCACC
down5′TTAAGCTTCCTGTCATTGAAGCAGGTGC3′ region of smu487AE014133
down3′GAATCAGGCATATAACCCGTATC
pluxS5′AAGGATCCGCATAACCAATAACCAAACCluxS promoterAE014133
pluxS3′TCCTGCAGAAAGCTTTCAACAGTAACTTC