TABLE 1.

Oligonucleotides used for gene knockouts

Gene and orientationSequence (5′ → 3′)
arsA reverseCGGTCACCTCAGTGATCGTC
arsA inverseCTGCGAATCCCCTGTCGAGACGA
arsC inverseGCGCGTTGTAGACCTGTTCG
arsC reverseAACAGACACCACCGGAACGC
2599 reverseCTACGCGAAGAACTGTGCCA
arsB 5′ inverseCGCTGACATGGTGCCACGGT
arsB 3′ inverseTGGGGCGTCTAAGGCGGATA
2603 forwardATGGAACAAGTGTGGGCAGA
5175 reverseCTATTTGAAATCCTGAAAGA
arsM 3′ inverseGACTGACCGGCCGAATCG
arsM 5′ inverseCATGGTTGCCTCGCAGGT
5176 forwardATGGTTCAGGACGCAACCGC
ura3 forwardATGAGCTTCGTCGAGGAACT
ura3 reverseCTACCGGTGGCGGTTCAGGC
bla forwardATGAGTATTCAACATTTCCG
bla reverseTTACCAATGCTTAATCAGTG
tbpC forwardATGACGGTCGAGATTGCGAA
tbpC reverseTTAAACTAATTCTTGGACTT