TABLE 2.

Oligonucleotides used for making probes

Gene and orientationSequence (5′ → 3′)
arsA forwardATGACTGCTACACAAACGCC
arsA reverseTCACGACACCGTCACCTCCT
arsD forwardATGACTCAACTCACCCTGTA
arsD reverseTTACGCTTCCTGTGGGTCTG
arsR forwardATGTCATCGACCGAGCGGTT
arsR reverseTCATCTGCGGGATCCGTTCA
arsC forwardATGTCTGCTGATTCGACGAC
arsC reverseTTAGTCGTCGGGATTGAACT
arsB forwardATGTCAGCGGTGTCACCACC
arsB reverseTTAGACGCCCCAGAAGGCCG
arsM forwardATGGTTCAGGACGCAACC
arsM reverseCTATCCGATTCTATTTGAAA
arsR2 forwardATGGTTCAGGACGCAACCGC
arsR2 reverseTTACTCATGGTTGCCTCGCA
Universal 16S 338FCTCCTACGGGAGGCAGCAG
Universal 16S 784RGGACTACCAGGGTATCTAATCC
Archaeal 16S 27FTCCGGTTGATCCTGCCGGAG
Archaeal 16S 685RTTACGGGATTTCACTCCTAC