TABLE 1.

Oligonucleotide primers used in this study

PrimerNucleotide sequenceCoordinatesa
AGCTCCCACATAACGGCCAGCATCAA4408179-4408203
BTGCGGTGAAACCTGCTGTGCCA4409757-4409736
CGAGCGGTAATGCCCGAGTCCTGCA4540805-4540828
DTTTGCACAGTGCCGTCAGGGTGGAG4543298-4543274
ECGAATTGTCAAGACCCTGAGCGTGA4530038-4530062
I43aDAGGCGTAGTGAATGCAGCAAAGCGC4414160-4414184
I43aRAGGCCACACGAACCCCTCGGGTATT4416883-4416859
I43bDCCCCCTCTCTGTTATGCCGTCTGCA4424290-4424313
I43bRACCGCCACCCAGCAGGAAATTACCC4427171-4427147
I43bD2TTTCTGCGTTGTGGGGTTCTGGGC4433591-4433614
I43bR2CCACCCGATCAAGCAAGGCAAGATG4436745-4436721
I43bD3ATAAGCCCCTCACCGGAAACCCGTC4454572-4454596
I43bR3CAGCACACGGGATTTCAGGCCTGTC4457403-4457379
sopED2GCTGACTTTGGTGCTGCTGCTCTCG4479697-4479721
sopER2CTGGCGTATGCGGGGTCTTTACTCG4482122-4482098
I45D1TCTCGCACTTTTTCGGGATGCTGA4512443-4512466
I45R1GCAACCATGCGAACCCATTCATTC4515144-4515121
I45D2TTCAGATACGCTACCGCCCCTGGC4523950-4523973
I45R2GGGGCTGGATCAGAAGCTCGTGCAA4526942-4526918
R1(H1+P1)TGGTTATGGGGAGGTGAGCTATGGCTAAAGCACCAC TGTTAATGTAGGCTGGAGCTGCTTCGb4412019-4412060
R1(H2+P2)AAACAACCCGTTAGTATTCTAGGCTGGCGAAGGTTTTCGTCTCATATGAATATCCTCCTTAGb4420739-4420698
  • a Coordinates are those of the S. enterica serovar Typhi CT18 sequence (45).

  • b Italics indicate the region that anneals to the 5′ or 3′ end of a kanamycin cassette flanked by the FRT sites in plasmid KD4.