Oligonucleotide primers

Primer or useSequence (5′-3′)Location or usea
    3732AATATGAAGTGCTTAGAAAG pfoR promoter region
    14715CCAATTATAATATGCATTCCATUpstream of VirR boxes
    14349GAAAATGCATACTTAAAGUpstream of pfoA
    14347TTTAAGTATGCATTTTCADownstream of VirR boxes
    14348CTCATGCATATTATAATTGGUpstream of VirR boxes
    17104GATATCCCAATTATAATATGCATTCCATTTATGIntroduces EcoRV site upstream of VirR box 1
    17116CCGGGTACCTACTTTAGTTTAATTGTAIntroduces Asp718 site at 5′ end of pfoA
    17117GATATCGTATTGAATGAGATTATTTCCTCTGIntroduces EcoRV site downstream of VirR box 2
Cloning of VirR boxes
    18705CCCAGTTATTCACGATTAGGTTCAAGCCCAGTTCTGCAC5-bp insertion between VirR boxes (+)
    18706GTGCAGAACTGGGCTTGAACCTAATCGTGAATAACTGGG5-bp insertion between VirR boxes (−)
    19211CCCAGTTATTCACGAGCCCAGTTCTGCAC5-bp deletion between VirR boxes (+)
    19212GTGCAGAACTGGGCTCGTGAATAACTGGG5-bp deletion between VirR boxes (−)
    19208CCCACTTTTACCTGTTTTTTGACCAGTTACGCACVirR boxes upstream of hyp7(+)
    19209GTGCGTAACTGGTCAAAAAACAGGTAAAAGTGGGVirR boxes upstream of hyp7(−)
    20974CCCAGTTATTCACGATTAAAGCCCAGTTCTGCACCCCAT5-bp insertion between VirR box 2 and −35 box (+)
    20975ATGGGGTGCAGAACTGGGCTTTAATCGTGAATAACTGGG5-bp insertion between VirR box 2 and −35 box (−)
    20976CCCAGTTATTCACGATTAAAGCCCAGTTCTGCACCCCATCCCAT10-bp insertion between VirR box 2 and −35 box (+)
    20977ATGGGATGGGGTGCAGAACTGGGCTTTAATCGTGAATAACTGGG10-bp insertion between VirR box 2 and −35 box (−)
Gel mobility shifts
    4565GGAACTCATATTATAATTGGUpstream of VirR boxes
    5126CTCTAATTTTTTCTTTTCCCDownstream of VirR boxes
    4566TTTAAGTAAACATTTTCATCDownstream of 5126
    4826TTTGCCTTATAATTTATTTC plc promoter region
    4824CTTTAGTTGATACCCCAGCCC plc promoter region
  • a +, sense primer; −, antisense primer.