TABLE 2.

Oligonucleotide primers

Primer or useSequence (5′-3′)Location or usea
PCR
    3732AATATGAAGTGCTTAGAAAGpfoR promoter region
    14715CCAATTATAATATGCATTCCATUpstream of VirR boxes
    14349GAAAATGCATACTTAAAGUpstream of pfoA
    5460CTCAGGTACCGAATCTAATACATGTAAACCDownstream of pfoA
    14347TTTAAGTATGCATTTTCADownstream of VirR boxes
    14348CTCATGCATATTATAATTGGUpstream of VirR boxes
    9373CGCGGATCCTGCTGGTTTTGCTGTAATGTWithin pfoR
    17104GATATCCCAATTATAATATGCATTCCATTTATGIntroduces EcoRV site upstream of VirR box 1
    17116CCGGGTACCTACTTTAGTTTAATTGTAIntroduces Asp718 site at 5′ end of pfoA
    17117GATATCGTATTGAATGAGATTATTTCCTCTGIntroduces EcoRV site downstream of VirR box 2
Cloning of VirR boxes
    17444CCCAGTTATTCACGATTAAAGCCCAGTTCTGCACWild-type VirR boxes (+)
    17443GTGCAGAACTGGGCTTTAATCGTGAATAACTGGGWild-type VirR boxes (−)
    18705CCCAGTTATTCACGATTAGGTTCAAGCCCAGTTCTGCAC5-bp insertion between VirR boxes (+)
    18706GTGCAGAACTGGGCTTGAACCTAATCGTGAATAACTGGG5-bp insertion between VirR boxes (−)
    18707CCCAGTTATTCACGATTAGGTTCCGATCAAGCCCAGTTCTGCAC10-bp insertion between VirR boxes (+)
    18708GTGCAGAACTGGGCTTGATCGGAACCTAATCGTGAATAACTGGG10-bp insertion between VirR boxes (−)
    19211CCCAGTTATTCACGAGCCCAGTTCTGCAC5-bp deletion between VirR boxes (+)
    19212GTGCAGAACTGGGCTCGTGAATAACTGGG5-bp deletion between VirR boxes (−)
    19190CCCAGTTTAACATAAAAAATGACCAGTTATGCACVirR boxes upstream of CPE0845 (+)
    19191GTGCATAACTGGTCATTTTTTATGTTAAACTGGGVirR boxes upstream of CPE0845 (−)
    19192ACCAGTTATGTATAAATTTTGACCAGTTATGCAAVirR boxes upstream of CPE0846 (+)
    19193TTGCATAACTGGTCAAAATTTATACATAACTGGTVirR boxes upstream of CPE0846 (−)
    19206CCCAATTATTCATAAAATATTGCCAGTTTTACACVirR boxes upstream of CPE0920 (+)
    19207GTGTAAAACTGGCAATATTTTATGAATAATTGGGVirR boxes upstream of CPE0920 (−)
    19208CCCACTTTTACCTGTTTTTTGACCAGTTACGCACVirR boxes upstream of hyp7(+)
    19209GTGCGTAACTGGTCAAAAAACAGGTAAAAGTGGGVirR boxes upstream of hyp7(−)
    20974CCCAGTTATTCACGATTAAAGCCCAGTTCTGCACCCCAT5-bp insertion between VirR box 2 and −35 box (+)
    20975ATGGGGTGCAGAACTGGGCTTTAATCGTGAATAACTGGG5-bp insertion between VirR box 2 and −35 box (−)
    20976CCCAGTTATTCACGATTAAAGCCCAGTTCTGCACCCCATCCCAT10-bp insertion between VirR box 2 and −35 box (+)
    20977ATGGGATGGGGTGCAGAACTGGGCTTTAATCGTGAATAACTGGG10-bp insertion between VirR box 2 and −35 box (−)
Gel mobility shifts
    4565GGAACTCATATTATAATTGGUpstream of VirR boxes
    5126CTCTAATTTTTTCTTTTCCCDownstream of VirR boxes
    4566TTTAAGTAAACATTTTCATCDownstream of 5126
    4826TTTGCCTTATAATTTATTTCplc promoter region
    4824CTTTAGTTGATACCCCAGCCCplc promoter region
  • a +, sense primer; −, antisense primer.