TABLE 1.

Southern DNA probes and oligonucleotides used in this study

Probe or oligonucleotideaDescription (reference) or nucleotide sequence (5′ to 3′)
Probes
    1Genomic B31 MI DNA clone pMM5 (7)
    2PCR amplified from Sh-2-82 DNA with primers A and B
    3PCR amplified from Sh-2-82 DNA with primers C and D
    4Genomic B31 MI DNA clone CZ32 (23)
    5Genomic B31 MI DNA clone DF29 (23)
Oligonucleotides
    ATATGTGGAGGATATATATATGAGC
    BAATATTTTTTTATGTTGTCACCTCG
    CTAAAAAATCCCCAATTAATTTA
    DATCTTTCGAGTCAAATTCAATAATAG
    EGTATTATAGATCTTGAGTTTGTTGGG
    FCAACTTGAACTGGTATTATAATATGG
  • a Probe locations are indicated in Fig. 1.