TABLE 1.

Sequences of primers and TaqMan probes used in this study

Primer or probeaOligonucleotide sequence (5′→3′)
cna-FCAAGCAGTTATTACACCAGACGG
cna-RCACCTTTTACAGTACCTT
arcA-FGTGGTTGACTCATACATCTAGGGC
arcA-RAGACCAGGCGTTGTAGTGACTTA
arcA-PCCCACGTCCACGTACCAGCTCGCT
pyrR-FTTGATGATGTGCTGTATACTGG
pyrR-RCGAATTGGTAACTCACGATGT
pyrR-PCGGTTCGTGCTTCACTTGATGCT
ureA-FCATTTTACACAACGAGAGCAAG
ureA-RACGTGCTTTACGACGACG
ureA-PCAACTTCCGCCGCCACTACAATCA
gyrB-FAGTAACGGATAACGGACGTGGTA
gyrB-RCCAACACCATGTAAACCACCAGAT
gyrB-PCCGCCACCGCCGAATTTACCACCA
spa-FGTAACGGCTTCATTCAAAGTCT
spa-RTCATAGAAAGCATTTTGTTGTTCT
spa-PAAAGACGACCCAAGCCAAAGCACT
  • a Forward (F) and reverse (R) primers and the Taqman probe (P) for the ORFs are shown.