TABLE 2.

Primers used of the identification of the cmp locus

PrimerSequence (5′ → 3′)Starting location (bp)
FMH617CGGGAACATCTTGGATAAT−88 of thiL
FMH618TCCGTCACTAACATCATTT637 of thiL
FMH619GCCTGAGCCAAGAGTAAGC581 of thiL
FMH620GTCGGACTGTTTACAATACG165 of ydiB
FMH621GGAGACGTCCTGACATTAGA191 of ydiB
FMH622GCGGTGCCATATCACAATCAT142 of ydiC
FMH623GCGCTGCTTCGAGAAGACAC45 of ydiC
FMH624GCCAGCCGCAAGTAATCCG634 of ydiC
FMH625GCGCCTTCAGAATTGGCTT608 of ydiC
FMH626GCAGTCTCATCACAGCTTGTT38 of gcp
FMH627CGCTTGAAGTGAGGTTTCG316 of ydiD
FMH628CGGTCCACCCGGATATGGC539 of gcp
FMH629GCGGCAGGAGAAGCCTAC495 of gcp
FMH630CCTCAGCCCTTTATCCATCAA+104 gcp
FMH649CGCTCCTTAAACAGATCATA−118 of ydiF
FMH650GGCTTTGAACCTGTGTAGA469 of ydiF
FMH651GGCGGTTATCAATATGAAGC399 of ydiF
FMH652GAGCATGAATGACACTTCTG1040 of ydiF
FMH653CAGAGCGGAAATGAAGTCCT961 of ydiF
FMH654GGGTCACATAGCAATTCATC1811 of ydiF
FMH655CCAACGACTCCGTCGGATT1722 of ydiF
FMH656CCCATTCGGACAAAAGAGATT1903 of ydiF
FMH657CAGCTGATTAGCTTGTAAGAT7 of ydiF
FMH658GCGCTTCCATTTCCACAC335 of ydiG
FMH659GTGCCATCCGCTTTCATTG225 of ydiG
FMH660CGGATGATACACGCTGTT109 of ydiH
FMH661CGGCTGCCGCTTTACTATCG43 of ydiH
FMH662CGGCATATTTGGGCTCCTC6 of tatAY
FMH663GGTCGGCATTAGGAATCAAG494 of ydiH
FMH664GCGCTACAATCAGCAACC79 of tatCY