TABLE 1.

Primers for construction of psl deletion mutants

PrimerSequence (5′ to 3′)Gene with deletionPCR stepProductSize (bp)
LF204GCTGGAGCCGGTGGGACGCAATACΔpslC (PA2233)Round 1 5′ primerRound 1 5′1,392
LF205CTAGCACTAGTAGCGGCAAGTACCTGTGGAACGΔpslC (PA2233)Round 2 5′ primerRound 2 5′1,073
LF206TACAGGGCACCGGCGGCACGGCTGGCCGGCTCGATGACCTCΔpsIC (PA2233)5′ sewing primerDeleted region579
LF207GCTTGAACTCGCGCTGGTAGATGAΔpslC (PA2233)Round 1 3′ primerRound 1 3′1,028
LF208CTAGGAGCTCTGACGCCGACGCCGATGGACTTGΔpslC (PA2233)Round 2 3′ primerRound 2 3′922
LF209GAGGTCATCGAGCCGGCCAGCCGTGCCGCCGGTGCCCTGTAΔpslC (PA2233)3′ sewing primerRound 2 product1,995
LF210GCCCCCGCCAGCGACGAGAAGAAΔpsID (PA2234)Round 1 5′ primerRound 1 5′1,039
LF211CTAGCACTAGTGCGCGGGTCGAGGTCATCΔpsID (PA2234)Round 2 5′ primerRound 2 5′854
LF212TTCAGGTAGACGTCGACGCCGGGAATCCGTGCGGGGGTGTTTGCΔpslD (PA2234)5′ sewing primerDeleted region615
LF213ATGTTGCTGATCTGGCTCTTGTCCΔpslD (PA2234)Round 1 3′ primerRound 1 3′1,423
LF214CTAGGAGCTCGAGTTCGGCGAGCTGCTTTTCCTGΔpslD (PA2234)Round 2 3′ primerRound 2 3′1,268
LF215GCAACACCCCCGCACGGATTCCCGGCGTCGACGTCTACCTGAAΔpslD (PA2234)3′ sewing primerRound 2 product2,122
LF222CGCGCCGAACACCCTGACCACTCΔpslF (PA2236)Round 1 5′ primerRound 1 5′1,014
LF223CTAGCACTAGTACGTCGACAGCCTGGAGAAATCΔpslF (PA2236)Round 2 5′ primerRound 2 5′813
LF224GGGTAGATGGCGCCGTTGCCCAGGGCGTTGCGGAAATGACTGΔpslF (PA2236)5′ sewing primerDeleted region909
LF225GTCCAGCGCACTCATCAGCΔpslF (PA2236)Round 1 3′ primerRound 1 3′1,123
LF226CTAGGAGCTCCGTCGGGCATCTCGCTGAAΔpslF (PA2236)Round 2 3′Round 2 3′831
LF227CAGTCATTTCCGCAACGCCCTGGGCAACGGCGCCATCTACCCΔpslF (PA2236)3′ sewing primerRound 2 product1,644