TABLE 1.

Bacterial strains, plasmids, and oligonucleotides used in this study

Strain, plasmid, or oligonucleotideDescription or sequenceSource or referencePlasmid(s) generateda
Strains
    E. faecalis
        JH2-2 rif fus 39
        FA2-2 rif fus 25
        OG1X str gel 36
        FA3333FA2-2 defective in cAD1 2
    E. coli
        DH5α endA1 recA1 gyrA96 thi-1 hsdR17 supE44 relA1 Δ(argF-lacZYA)U169 φ80lacZΔM15BRL
        BL21(DE3)pLysSF ompT rB mB DE3Invitrogen
Plasmids
    pAM714pAD1::Tn917; erm; Agg Tra 35
    pAM330pAD1::pAD2; erm km str 12
    pAM330Δ9pAM330 with deletion repAΔ9 This study
    pET30aExpression vectorNovagen
    pASK60Expression vectorBiometra
    pSU18 E. coli cloning vector, cm, p15A 4
    pAM88Suicide vector; cm, p15A, cm + 22
    pDAK246ΔEpAD1 minireplicon; erm par 53
    pAM3314504-bp internal repA cloned in pAM401 3
    pAM3316209-bp internal repA cloned in pAM401 3
    pAM3318158-bp internal repA cloned in pAM401 3
    pAM88A* repA (frameshift) cloned in pAM88This study
    pAM88It It region cloned in pAM88This study
    pAM88-3314504-bp internal repA cloned in pAM88This study
    pAM88-3316209-bp internal repA cloned in pAM88This study
    pAM88-3318158-bp internal repA cloned in pAM88This study
    pAM88oriVMfeI-RsaI 170-bp repA cloned in pAM88This study
    pSU18b bac promoter cloned in pSU18This study
    pSU18b* bac* promoter cloned in pSU18This study
    pAM434b* bac* promoter cloned in pAM434This study
    pAM434brepA bacrepA cloned in pAM434This study
    pAM434brepAΔ9 bacrepAΔ9 cloned in pAM434This study
    pAM88ABCpAD1 rep region cloned in pAM88This study
    pAM88AΔ9BCpAD1 rep(Δ9) region cloned in pAM88This study
    pET30aRepA repA gene cloned in pET30aThis study
    pET30aRepA5′5′ repA gene cloned in pET30aThis study
    pET30aRepA3′3′ repA gene cloned in pET30aThis study
    pASK60RepA repA gene cloned in pASK60This study
    pASK60RepB repB gene cloned in pASK60This study
    pAM26037.5-kb pAD1 replication proficient region 1
    pBluescript E. coli cloning vector; ap Stratagene
    pTAd E. coli cloning vector; ap, km Clontech
    pTAdA repA cloned in pTAdThis study
    pTAdA* repA (frameshift) cloned in pTAdThis study
    pTAdAΔ9 repAΔ9 cloned in pTAdThis study
    pTAdItIt region in pTAdThis study
    pTAdIt5′5′ Iteron repeats (see Fig. 1A) in pTAdThis study
    pTAdIt3′3′ Iteron repeats (see Fig. 1A) in pTAdThis study
    pBlueScriptoriV oriV region (see Fig. 1) in pBlueScriptThis study
    pTAdIR1IR1 repeats (see Fig. 5A) in pTAdThis study
    pTAdIR1*IR1* repeats (see Fig. 5A) in pTAdThis study
    pTAdItCItC repeats (see Fig. 1A) in pTAdThis study
    pAM88A*-IR3 + 4pAM88A* with mutated IR-1 repeats 3 and 4This study
    pAM88A*-IR1 + 2pAM88A* with mutated IR-1 repeats 1 and 2This study
    pAM88A*-IR1 + 2 + 3 + 4pAM88A* with mutated IR-1 repeats 1, 2, 3, and 4This study
    pAM88A*-5×IRpAM88A* with all five IR-1 repeats mutatedThis study
Oligonucleotides
    RepATTCATTGTAAATACGGTTpAM88It
    RepBCTTCCCAACGCCGCCpAM88It, pTAdIt3′
    It1TTAAGAATACCAAAACATTATTpTAdIt5′
    It2CCTTTCTACAAAAGGATTpTAdIt5′
    It3CCTTTTGTAGAAAGGTTpTAdIt3′
    401AGAGCAAGAGATTACGCGCAGpAM88/3314, 6, 8
    401BTGCCGGCCACGATGCGTCCpAM88/3314, 6, 8
    ETrepA.1CCCAGATCTGAACAACTTCAAATTTTTTAATGTpAM88A*, pET30aRepA, and pET30aRepA5′
    ETrepA.2CCCAAGCTTATTGATTTTCAACCCAGTTpAM88A*, pET30aRepA, and pET30aRepA3′
    ETrepA.3CCCAAGCTTAACCAAGGGATTCAGCGTTpET30aRepA5′
    ETrepA.4CCCAGATCTAACAAACGCTGAATCCCpET30aRepA3′
    ASK60repB.1TTTAACGGCCGGCATGGTTAAAAAAATTGTATTpASK60repB
    ASK60repB.2ATTTTTCGCGACTCATTAGCAGTCGTCCCTTCpASK60repB
    ASK60repA.1TTTAACGGCCGGCATGAACAACTTCAAATTTTTTAATGTpAM434brepA, Δ9, pASK60repA
    ASK60repA.2ATTTTTCGCGATTGATTTTCAACCCAGTTpAM434brepA, Δ9, pASK60repA
    Bac1AGAGCGTCGACTGATTGAApAM434b*
    Bac2GGGGTACCGTCGATCTTATCGCGATTpAM434b*
    ItCsTTTTTTACTATCTTACTATTTTACTACpTAdItC
    ItCasATTTTTTGTAGTAAAATAGTAAGATAGpTAdItC
    IR1sAATTGAATCAAGAGGGTATGAAAATCATACCCTGCCAAAACpTAdIR1
    IR1asAATTGTTTTGGCAGGGTATGATTTTCATACCCTCTTGATTCpTAdIR1
    IR1*sAATTGAATCAAGAGCCTTTCAAAATGAAAGGCTGCCAAAACpTAdIR1*
    IR1*asAATTGTTTTGGCAGCCTTTCATTTTGAAAGGCTCTTGATTCpTAdIR1*
    TraBCAAGATAATACGTTTTATTAGACAC
    M1sCAAAACGTTGATAAATCAGAGCCTTTGAAAATCAGTpAM88A*-5×IR
    M1asACTGATTTTCAAAGGCTCTGATTTATCAACGTTTTGpAM88A*-5×IR
    M2GAGCCTTTCAAAATGAAAGGCTGCCAAAACGTTGATAAATCAGpAM88A*-IR3 + 4
    M3GCAGCCTTTCATTTTGAAAGGCTCTTGATTACCAAGGGATTCpAM88A*-IR3 + 4
    M4GAGCCTTTCAAAATGAAAGGCTCCCCCCAAAGAAAAACAAApAM88A*-IR1 + 2, pAM88A*-IR1 + 2 + 3 + 4
    M5GGAGCCTTTCATTTTGAAAGGCTCTGATTTATCAACGTTTTCpAM88A*-IR1 + 2, pAM88A*-IR1 + 2 + 3 + 4
  • a For clarity, only relevant plasmids generated by using the specific oligonucleotides are indicated.