TABLE 1.

Primers used for RT-PCR and real-time RT-PCR analyses of transcripts of tgs, dosR, and 23S rRNA genes

Primer for tgs, dosR, or 23S rRNA genePrimer sequence (5′-3′)aProduct length (bp)
RT-PCR primers
    Rv3130cF: CGTGCTAAGTCCCGCCGCGTCGTC737
R: CTCCGCGCCTGCGAGTCACCTTGC
    Rv3734cF: GGTGGAATCGCCCGTGTGGCATGG765
R: TGGGTCGTCGACATGGGTGGCGAG
    Rv3234cF: CTGGCCAGGCCGGTGTGGATCGAC595
R: AGTCGTAGCGAGCCCGCACCGTGC
    Rv3088F: CCGCGCCTGTTCGATGCCTACCGG780
R: CATGAACGCCACCAGCGGCCGGTC
    Rv1760F: ACCTCGACGATGCCGGGCGGCTAC750
R: GCCGTGCTCGAGTAGGAAGCGCCG
    Rv2285F: CGACCTGCCTAAGGGAGCACCGCG722
R: CCTGCAGGTAGCGTCGGCAAGCCC
    Rv0221F: GGGGGATGGATCTGCTGCCGGGAC715
R: AGATCTCGGTGACCAGCGCGGCCC
    Rv3740cF: GAGCATCCGCTGCATGTCGGCGCG792
R: CGTGTCCGGCAGCGCGTCGTTGTC
    Rv3087F: CCGGTCTTCCGGCTGCGGTACCTG721
R: TCGTGGCCACCATCGCGTCGGTGG
    Rv3371F: CGACCTCACCCAGCACGTGCGACG703
R: GGGTTGACGACGGCCGCTCTGCTG
    Rv3480cF: AGCCTGTCCACCGACCCGCACGAC812
R: CGCAGGTAGAGCACGTCCTCGGGC
    Rv1425F: GACTGGACCGGCCGTGGTTCGTCG802
R: GTGCTCTCGTGGATGGCCGCCAGG
    Rv0895F: GGTCGCTCACCTCGCTCGGGCAGT751
R: CCTGGACCCTGGCCGAACACGTCG
    Rv2484cF: GGCGAGTCCCCCAGGTTGTCCGAC762
R: CTCGGTACGGGTGGTCAGGCTGCG
    dosR (Rv3133c)F: GGTCGATGACCACGAGGTGGTGCGT496
R: GGCGATCTGCTTGTTGGTCAGGCCC
    23S rRNAF: GTGGCGTGTTCTGGACCCGAAGCG730
R: GTCCATCGACTACGCCTGTCGGCC
Real-time RT-PCR primers
    Rv3130cF: AACGAAGACCAGTTATTCGAGC206
R: CTCATACTTTCATCGGAGAGCC
    Rv3734cF: TACTACCTGATAGAGCGGAATGC215
R: TCGGAGAGCACTTTCTTGTTG
    Rv3234cF: GTATGTCGGGTTGCTGTTGAT241
R: GTGCAGTTGCTCGTCACTACC
    Rv3088F: TGTGGTGATATCAAACATGAAGG241
R: GGTTTGGAGCTCGGTGAAT
    dosR (Rv3133c)F: GTCGTCAAAGACATCAAGGGAAT246
R: CGTCTTTTCGGCTAGGAACATT
    23S rRNAF: ACGACACTTTCTGACTGCCTCTC224
R: TCTGAATATATAGGGTGCGGGAG
  • a F, forward primer; R, reverse primer.