TABLE 2.

ASO-PCR primer sequences and predicted product sizes.

LineagePrimerPrimer sequencesa (5′-3′)PCR product size (bp)
1 actA1-fAATAACAACAGTGAACAAAGC 373
actA1-rTATCACGTACCCATTTACC
2 plcB2-fTTGTGATGAATACTTACAAAC564
plcB2-rTTTGCTACCATGTCTTCC
3 actA3-fCGGCGAACCATACAACAT277
plcB3-rTGTGGTAATTTGCTGTCG
  • a Underlined nucleotides are specific to the L. monocytogenes lineage listed in the first column.