TABLE 2.

Specific primers designed for PCR amplification and driven cloning strategy

PrimerSequence (5′-3′)aDNAb templateCloning strategyRecombinant plasmid
O-hmgA5 O-hmgA3GGGGAGCTCGCTTTGGCCATGGGAGGGGAGGTT CAAGGTACCGGCGGCGAACCGTTCACTTCKT2440The 3,396-bp PhmgABC fragment that was PCR generated was double digested with SacI/KpnI and cloned into pUC18pU-HMG
O-hpd5TCCGGATCCCACGCAATCAATAATTTTCGCKT2440The 1,134-bp hpd gene that was PCR generated was double digested with KpnI/BamHI and cloned into pUC18pU-hpd
O-hpd3ACGGTACTCTAGAGGCGATCAGTCTGTGCThe 819-bp hpd internal fragment that was PCR generated was double digested with EcoRI/SalI and cloned into pK18mobpK-dhpd
O-tyrB5 O-tyrB3GGCTCTAGACTGTACGCCCTATCACACTC CCCTCTAGAAGTCAACCCACCCCCCAGKT2440The 1,278-bp tyrB1 gene that was PCR generated was digested with XbaI and cloned into pUC18pU-tyrBI
O-hmgR5E O-hmgR3GATGAATTCGGAACCTCCCCTC TATGTCGACTTCTCTCAGGAACTGCKT2440The 866-bp hmgR gene that was PCR generated was double digested with EcoRI/SalI and cloned into pQE32pQ-hmgR
O-dphhA5 O-dphhA3AGAGCATGCGGTGTGGAACACCC CCTGGATCCGGTCGAAGGCCTGGKT2440Cloning into pK18mob of the PCR-generated fragment digested with SphI/BamHI that contained a 539-bp internal sequence of phhApK-dphhA
O-dhmgA5 O-dhmgA3CTGTCGACGAGCCCGCAGCCGATTCCT ACGGTACCTGTTCTCGGCCACCAKT2440The 677-bp hmgA internal fragment that was PCR-generated was double digested with SalI/KpnI and cloned into pK18mobpK-dhmgA
O-dhmgR5 O-dhmgR3GGCGTCGACGCATCCACCCCCGGCATCAGC GGGGTACCCGAACAGGATGCGGCCACCACCKT2440The 428-bp hmgR internal fragment that was PCR generated was double digested with SalI/KpnI and cloned into pK18mobpK-dhmgR
O-Phmg5 O-Phmg3GTGGTACCGACGTCGAGGGTGAGAGT GGGGATCCGGGGCCTTCTGCGGGGAGTTCTGCKT2440The 335-bp hmgR-hmgA intergenic region that was PCR generated was double digested with KpnI/BamHI and cloned into pSJ3pSJ-Phmg-lacZ
HGA(5)2 HGA(3)8CCGGCCGGCGTGAGCATCTACATCTACTG CTCGGCCACCATCCAGCGCGGUThe 592-bp hmgA internal fragment that was PCR generated was cloned into pGEM-T easy and then digested with EcoRI and subcloned into pK18mobpKhmgA
HGA(5)4 HGA(3)3CCGCCCCGACAACCCGCTGCTAC GCGGCTGCGGGTCACCTTCGGGUThe 433-bp hmgB internal fragment that was PCR generated was cloned into pGEM-T easy and then digested with EcoRI and subcloned into pK18mobpKhmgB
HGA(5)6 HGA(3)5GGCCTTGCGCACCGACGGTGG CCGATCCACTGGTTGACCTGCCCCTCUThe 233-bp hmgC internal fragment that was PCR generated was cloned into pGEM-T easy and then digested with EcoRI and subcloned into pK18mobpKhmgC
HPD(5)2GCCGATGGAGCTGCGCCTGCCGUThe 378-bp hpd internal fragment that was PCR generated was cloned into pGEM-T easy and then digested with EcoRI and subcloned into pK18mobpKhpd
HPD(3)2GAACTGCATCAGGAACTCTTCAATCTGGCCThe 378-bp hpd internal fragment that was PCR generated was cloned into pGEM-T easy and then digested with EcoRI and subcloned into pJQ200KSpJQhpd
Phh(3)4 Phh(5)4CTGGTGCTCAGGCTCGTCAGACAGACTGTAGAC CAACTGGGCGAGATCAACAAGGTGCTGGGUThe 419-bp phhA internal fragment that was PCR generated was cloned into pGEM-T easy and then digested with EcoRI and subcloned into pK18mobpKphhA
Hpd(5) Hpd(3)4AATCAATAATTTTCGCTGCAGATGAG AGATCGTCCCCTCGCTGATGCTGGTGGUCloning into pGEM-T easy of the PCR-generated fragment (1,245 bp) that contained the Hpd-coding region behind the lac promoterpGhpd
HpdBam HpdPstB HpdPstX HpdXbaTCTTCGAGGATCCAATGGGCC TTTCAACCTGCAGGGCGCCCA GAGCGGCTGCAGGGTCACGG GGCGGCGCTATCTAGAGGGTATCAGTCGGTGCUThe PCR-amplified 5′ end (primers HpdBam and HpdPstB) and 3′ end (primers HpdPstX and HpdXba) of the hpd gene were cloned in pJQ200KS as BamHI/PstI and PstI/XbaI fragments, respectivelypJQhpdBX
HmgBam HmgPstB HmgPstX HmgXbaCTACCTCAGCGGATCCGGCAAC GAAGAACACTCGCTGCAGGGAACGG TTTATCCACAGCCTGCAGTGC GGATGCGCGGGAAGCTCTAGAGGUThe PCR-amplified 5′ end of hmgA (primers HmgBam and HmgPstB) and 3′ end of hmgC (primers HmgPstX and HmgXba) were digested with BamHI/PstI and PstI/XbaI respectively, and cloned into pJQ200KS to delete the hmg operon in P. putida UpJQhmgBX
HmgA(5) HGA(3)6GCCAGCAACTAGTCAGTCAGAGCCCGGAGG GGCAAGCTTCCGGCGGCGAACCUThe PCR-amplified fragment (3,306 bp) containing the hmgABC genes was cloned into pBBR1MCS-3pMChmg
  • a Engineered restriction sites are underlined.

  • b Each PCR was carried out with the two primers indicated and the genomic DNA of P. putida KT2440 or P. putida U as the template.